Incidental Mutation 'R5893:C330027C09Rik'
ID457338
Institutional Source Beutler Lab
Gene Symbol C330027C09Rik
Ensembl Gene ENSMUSG00000033031
Gene NameRIKEN cDNA C330027C09 gene
SynonymsCip2a
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48994185-49019709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48997500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 78 (S78G)
Ref Sequence ENSEMBL: ENSMUSP00000113075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048374] [ENSMUST00000114516] [ENSMUST00000117994] [ENSMUST00000121869] [ENSMUST00000125278]
Predicted Effect probably benign
Transcript: ENSMUST00000048374
AA Change: S78G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044714
Gene: ENSMUSG00000033031
AA Change: S78G

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 3e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117994
AA Change: S78G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113075
Gene: ENSMUSG00000033031
AA Change: S78G

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 2e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121869
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127995
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele display oligozoospermia, small epididymis and impaired spermatogonial progenitor cell maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in C330027C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C330027C09Rik APN 16 49001815 missense probably damaging 1.00
IGL00788:C330027C09Rik APN 16 49009069 splice site probably benign
IGL01343:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01348:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01876:C330027C09Rik APN 16 49001678 missense probably damaging 1.00
IGL02255:C330027C09Rik APN 16 49010813 missense probably damaging 0.99
IGL02515:C330027C09Rik APN 16 49005733 missense possibly damaging 0.47
IGL03295:C330027C09Rik APN 16 48994341 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0031:C330027C09Rik UTSW 16 49017373 missense probably benign 0.14
R0612:C330027C09Rik UTSW 16 48999039 missense probably benign 0.04
R1187:C330027C09Rik UTSW 16 49000293 missense probably damaging 1.00
R1707:C330027C09Rik UTSW 16 49018404 missense probably damaging 1.00
R1711:C330027C09Rik UTSW 16 49017486 missense probably benign 0.31
R1715:C330027C09Rik UTSW 16 49005719 missense probably benign 0.18
R2000:C330027C09Rik UTSW 16 49014969 missense probably damaging 0.99
R2002:C330027C09Rik UTSW 16 49005851 splice site probably benign
R2360:C330027C09Rik UTSW 16 49017465 nonsense probably null
R4093:C330027C09Rik UTSW 16 49000976 splice site probably benign
R4292:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4293:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4295:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4726:C330027C09Rik UTSW 16 49014070 missense probably benign 0.02
R4925:C330027C09Rik UTSW 16 49016363 critical splice donor site probably null
R5735:C330027C09Rik UTSW 16 49017493 critical splice donor site probably null
R6146:C330027C09Rik UTSW 16 48994329 nonsense probably null
R6649:C330027C09Rik UTSW 16 49017466 missense probably damaging 1.00
R7235:C330027C09Rik UTSW 16 49001059 missense probably damaging 1.00
R7300:C330027C09Rik UTSW 16 49013854 missense probably damaging 1.00
R7325:C330027C09Rik UTSW 16 49005821 missense probably benign 0.32
R7365:C330027C09Rik UTSW 16 49001653 missense probably benign 0.35
R7414:C330027C09Rik UTSW 16 49001635 missense probably benign 0.21
R7715:C330027C09Rik UTSW 16 49013984 missense probably damaging 0.99
R7780:C330027C09Rik UTSW 16 49001660 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCTAAACTGGGAAAGAAAGGGC -3'
(R):5'- CAATTTGTCTGTAGGAACTTTGAGG -3'

Sequencing Primer
(F):5'- GGAATTGAAATAAAAATTGCCAGCCC -3'
(R):5'- TCTGTAGGAACTTTGAGGTATCTG -3'
Posted On2017-02-15