Incidental Mutation 'R5893:Kctd1'
ID 457340
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 044094-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5893 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15102745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 812 (E812G)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000025992
AA Change: E216G

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: E216G

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: E812G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: E812G

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 C T 4: 144,429,766 (GRCm39) V408I probably benign Het
Ablim1 T A 19: 57,204,285 (GRCm39) R35S probably benign Het
Acacb A T 5: 114,367,912 (GRCm39) I1637F probably benign Het
Adamts18 A T 8: 114,499,709 (GRCm39) C402S probably damaging Het
Adra2b T A 2: 127,206,402 (GRCm39) D306E probably benign Het
Ammecr1l C T 18: 31,911,973 (GRCm39) T263I probably damaging Het
Antxr1 T C 6: 87,114,241 (GRCm39) I509V probably benign Het
Bahcc1 A G 11: 120,176,256 (GRCm39) E1967G probably damaging Het
Brap T A 5: 121,817,405 (GRCm39) Y337* probably null Het
Brca2 T C 5: 150,492,603 (GRCm39) V3206A probably benign Het
Cacna1e A T 1: 154,313,069 (GRCm39) F1486I probably damaging Het
Cbx4 A G 11: 118,973,016 (GRCm39) Y120H probably damaging Het
Ccar2 T A 14: 70,388,800 (GRCm39) Q137L probably benign Het
Ceacam12 A G 7: 17,803,299 (GRCm39) D235G probably damaging Het
Celsr1 A G 15: 85,788,215 (GRCm39) V2679A probably benign Het
Champ1 C T 8: 13,928,777 (GRCm39) P312S probably benign Het
Chst5 A G 8: 112,616,828 (GRCm39) L264S probably damaging Het
Cip2a A G 16: 48,817,863 (GRCm39) S78G probably benign Het
Colec10 T A 15: 54,274,185 (GRCm39) F4L probably benign Het
Cyp2a4 G A 7: 26,008,353 (GRCm39) G165D probably damaging Het
Cyp2c29 G C 19: 39,318,833 (GRCm39) A438P possibly damaging Het
Dlat A G 9: 50,555,439 (GRCm39) probably benign Het
Dmxl2 A G 9: 54,294,704 (GRCm39) V2457A possibly damaging Het
Dnah7a A G 1: 53,496,944 (GRCm39) M3104T possibly damaging Het
Dock8 C T 19: 25,099,811 (GRCm39) H645Y probably damaging Het
Ehbp1l1 T C 19: 5,768,459 (GRCm39) E948G probably benign Het
Eps8l2 C T 7: 140,937,537 (GRCm39) R384C probably damaging Het
Fam174a A T 1: 95,252,884 (GRCm39) N162I probably damaging Het
Fbp2 T A 13: 62,984,916 (GRCm39) N335I probably benign Het
Foxred2 C A 15: 77,831,344 (GRCm39) G490C probably damaging Het
Fyttd1 T G 16: 32,719,283 (GRCm39) D200E probably damaging Het
Gdf15 A T 8: 71,082,473 (GRCm39) V211E possibly damaging Het
Gm6214 A G 3: 140,545,107 (GRCm39) noncoding transcript Het
Havcr2 A G 11: 46,347,143 (GRCm39) Y40C probably damaging Het
Htra1 T G 7: 130,563,321 (GRCm39) V184G probably damaging Het
Hydin A T 8: 111,217,308 (GRCm39) I1399F probably benign Het
Igtp T C 11: 58,097,474 (GRCm39) L215P probably damaging Het
Lap3 T C 5: 45,668,621 (GRCm39) probably benign Het
Lgalsl2 A T 7: 5,362,623 (GRCm39) T85S probably benign Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Mtnr1b A T 9: 15,774,540 (GRCm39) V173E probably damaging Het
Nat10 A C 2: 103,552,184 (GRCm39) probably benign Het
Ndfip2 T A 14: 105,532,291 (GRCm39) V229E probably damaging Het
Nefh G A 11: 4,891,323 (GRCm39) T432M probably damaging Het
Nfe2l3 A G 6: 51,434,832 (GRCm39) Y464C probably damaging Het
Nrip1 C A 16: 76,090,841 (GRCm39) A239S probably damaging Het
Olfml2b A G 1: 170,490,042 (GRCm39) S221G probably benign Het
Orc4 G T 2: 48,795,559 (GRCm39) S389* probably null Het
P4hb A G 11: 120,462,476 (GRCm39) S77P probably damaging Het
Pcyt2 T C 11: 120,508,623 (GRCm39) probably null Het
Plagl1 T C 10: 13,003,938 (GRCm39) probably benign Het
Poglut1 C T 16: 38,349,957 (GRCm39) R272Q probably damaging Het
Pramel26 T A 4: 143,537,038 (GRCm39) Y431F probably damaging Het
Rdh5 T C 10: 128,750,090 (GRCm39) probably null Het
Rogdi A T 16: 4,831,258 (GRCm39) L3* probably null Het
Skap1 T C 11: 96,472,224 (GRCm39) *166Q probably null Het
Slc38a4 A G 15: 96,897,432 (GRCm39) I461T probably benign Het
Snx31 A C 15: 36,523,601 (GRCm39) I360M probably damaging Het
Spata22 A T 11: 73,227,073 (GRCm39) K96* probably null Het
Strn3 A T 12: 51,690,006 (GRCm39) probably null Het
Trip12 A C 1: 84,736,884 (GRCm39) probably benign Het
Uggt1 A T 1: 36,266,709 (GRCm39) probably null Het
Upk3a A C 15: 84,903,538 (GRCm39) D79A probably damaging Het
Uts2r A T 11: 121,052,105 (GRCm39) Y323F probably benign Het
Vmn2r1 A T 3: 63,993,974 (GRCm39) N107Y probably damaging Het
Vps13c A T 9: 67,810,121 (GRCm39) probably null Het
Wnt7b A G 15: 85,465,575 (GRCm39) probably benign Het
Zfp410 T A 12: 84,384,385 (GRCm39) probably null Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15,195,580 (GRCm39) missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15,195,822 (GRCm39) missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15,196,573 (GRCm39) intron probably benign
R6175:Kctd1 UTSW 18 15,102,688 (GRCm39) nonsense probably null
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8085:Kctd1 UTSW 18 15,140,901 (GRCm39) missense possibly damaging 0.95
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCCAGCTGCACACAAATG -3'
(R):5'- AAACTGGACCGTTACAGAATCTTC -3'

Sequencing Primer
(F):5'- AGCTGCACACAAATGTCCCTTTTC -3'
(R):5'- ACCATGGCCCTATACATGCTGG -3'
Posted On 2017-02-15