Incidental Mutation 'R5894:Sohlh1'
ID 457347
Institutional Source Beutler Lab
Gene Symbol Sohlh1
Ensembl Gene ENSMUSG00000059625
Gene Name spermatogenesis and oogenesis specific basic helix-loop-helix 1
Synonyms NOHLH, LOC227631
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R5894 (G1)
Quality Score 199
Status Not validated
Chromosome 2
Chromosomal Location 25842995-25847248 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25844667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 205 (S205P)
Ref Sequence ENSEMBL: ENSMUSP00000076253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076989]
AlphaFold Q6IUP1
Predicted Effect possibly damaging
Transcript: ENSMUST00000076989
AA Change: S205P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076253
Gene: ENSMUSG00000059625
AA Change: S205P

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
HLH 60 110 7.88e-2 SMART
low complexity region 177 188 N/A INTRINSIC
low complexity region 200 213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of testis-specific transcription factors which are essential for spermatogenesis, oogenesis and folliculogenesis. This gene is located on chromosome 9. Mutations in this gene are associated with nonobstructive azoospermia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Targeted mutation of this gene results in abnormalities in male reproductive physiology including spermatocyte production and testis morphologly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Sohlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Sohlh1 APN 2 25846861 splice site probably benign
IGL03116:Sohlh1 APN 2 25845648 splice site probably null
R0172:Sohlh1 UTSW 2 25846203 splice site probably null
R1465:Sohlh1 UTSW 2 25843347 missense probably damaging 1.00
R1465:Sohlh1 UTSW 2 25843347 missense probably damaging 1.00
R2161:Sohlh1 UTSW 2 25844636 missense probably benign
R4081:Sohlh1 UTSW 2 25845722 missense probably benign 0.33
R7715:Sohlh1 UTSW 2 25844628 missense possibly damaging 0.73
R7809:Sohlh1 UTSW 2 25845277 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGACTAGTGCTAGGCCATAGG -3'
(R):5'- TGAGCAATCCAAGGCCTAGAG -3'

Sequencing Primer
(F):5'- CATAGGCAGGCCAGTGACAC -3'
(R):5'- AGGCCTAGAGACTACTTTTCCAGG -3'
Posted On 2017-02-15