Incidental Mutation 'R0558:Pias1'
ID45735
Institutional Source Beutler Lab
Gene Symbol Pias1
Ensembl Gene ENSMUSG00000032405
Gene Nameprotein inhibitor of activated STAT 1
SynonymsDdxbp1, GBP, 2900068C24Rik
MMRRC Submission 038750-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62878368-62987924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62882009 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 639 (S639P)
Ref Sequence ENSEMBL: ENSMUSP00000096248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098651
AA Change: S639P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: S639P

DomainStartEndE-ValueType
SAP 11 45 5.3e-5 SMART
low complexity region 82 95 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:PINIT 135 286 9.6e-41 PFAM
Pfam:zf-MIZ 331 380 1.4e-23 PFAM
low complexity region 465 474 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214830
Predicted Effect probably benign
Transcript: ENSMUST00000215501
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Pias1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pias1 APN 9 62923296 missense probably damaging 0.96
IGL01011:Pias1 APN 9 62912855 missense probably benign 0.00
IGL02412:Pias1 APN 9 62893139 missense probably benign 0.44
IGL02728:Pias1 APN 9 62923644 missense probably damaging 1.00
IGL02728:Pias1 APN 9 62923645 missense possibly damaging 0.80
R0479:Pias1 UTSW 9 62893118 splice site probably benign
R0494:Pias1 UTSW 9 62887311 nonsense probably null
R0524:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R1279:Pias1 UTSW 9 62892145 missense probably damaging 0.98
R1525:Pias1 UTSW 9 62920487 missense probably damaging 1.00
R1769:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R2157:Pias1 UTSW 9 62912830 missense possibly damaging 0.63
R2201:Pias1 UTSW 9 62951855 missense possibly damaging 0.94
R4193:Pias1 UTSW 9 62952004 missense possibly damaging 0.80
R4726:Pias1 UTSW 9 62920489 missense probably damaging 0.96
R4880:Pias1 UTSW 9 62912798 missense probably benign 0.32
R5107:Pias1 UTSW 9 62882228 missense probably benign 0.11
R5574:Pias1 UTSW 9 62920493 missense probably damaging 0.99
R5634:Pias1 UTSW 9 62895973 missense probably benign 0.10
R5869:Pias1 UTSW 9 62912766 missense probably benign 0.06
R6518:Pias1 UTSW 9 62951860 missense probably damaging 1.00
R6634:Pias1 UTSW 9 62919424 missense probably damaging 1.00
R6798:Pias1 UTSW 9 62892169 missense probably benign
R6799:Pias1 UTSW 9 62882052 missense probably benign 0.10
R7099:Pias1 UTSW 9 62881145 missense
X0017:Pias1 UTSW 9 62980845 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCACAGGACAAATGGTGAAGTCTTCAG -3'
(R):5'- TGTTTCTCGACCAGCTAAGTGCAG -3'

Sequencing Primer
(F):5'- TGGGTGCTTGttttttctttttc -3'
(R):5'- AGGAGGGAGCACATCTCTG -3'
Posted On2013-06-11