Incidental Mutation 'R5894:Slc44a5'
ID 457363
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Name solute carrier family 44, member 5
Synonyms LOC242259
MMRRC Submission 043238-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R5894 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 153679073-153977359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153962210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 381 (Y381C)
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
AlphaFold Q5RJI2
Predicted Effect probably damaging
Transcript: ENSMUST00000089948
AA Change: Y381C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: Y381C

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,356,680 (GRCm39) E76V probably benign Het
Adcy2 A T 13: 68,773,971 (GRCm39) I1024N probably damaging Het
Agr2 A C 12: 36,045,509 (GRCm39) probably benign Het
Alpk2 T A 18: 65,414,143 (GRCm39) H1991L probably damaging Het
Amotl2 T A 9: 102,602,371 (GRCm39) M448K possibly damaging Het
Ankhd1 T A 18: 36,780,577 (GRCm39) F1876L probably damaging Het
Arl14 T C 3: 69,130,009 (GRCm39) V52A probably benign Het
Atp6v1b2 T A 8: 69,560,218 (GRCm39) probably null Het
Bmal2 A G 6: 146,724,732 (GRCm39) T409A possibly damaging Het
Bpifb4 G A 2: 153,782,852 (GRCm39) R19H possibly damaging Het
Cdh9 T A 15: 16,832,186 (GRCm39) L358I possibly damaging Het
Ces2h T G 8: 105,745,658 (GRCm39) I460M probably benign Het
Cog2 T C 8: 125,272,006 (GRCm39) Y507H probably benign Het
Crlf3 T A 11: 79,948,678 (GRCm39) R256W probably damaging Het
Csdc2 T A 15: 81,832,881 (GRCm39) F96I probably damaging Het
Csk A C 9: 57,535,958 (GRCm39) I264S probably damaging Het
Cyp2c29 G C 19: 39,318,833 (GRCm39) A438P possibly damaging Het
Ddx43 G A 9: 78,324,016 (GRCm39) G449D probably damaging Het
Fbxw18 G T 9: 109,529,235 (GRCm39) A106E possibly damaging Het
Fchsd2 C T 7: 100,840,959 (GRCm39) T156I probably benign Het
Frs2 T A 10: 116,917,011 (GRCm39) probably benign Het
Gm57858 C T 3: 36,074,124 (GRCm39) E342K possibly damaging Het
Grid2ip A T 5: 143,374,666 (GRCm39) T922S probably damaging Het
Grm1 A G 10: 10,955,999 (GRCm39) L95P probably damaging Het
Ift140 T C 17: 25,252,893 (GRCm39) V348A possibly damaging Het
Insr A G 8: 3,224,869 (GRCm39) S200P possibly damaging Het
Ints12 A T 3: 132,804,319 (GRCm39) D102V probably damaging Het
Kank1 A G 19: 25,401,564 (GRCm39) D1057G probably damaging Het
Kng1 T A 16: 22,892,113 (GRCm39) D225E probably benign Het
Lama1 A T 17: 68,086,042 (GRCm39) probably null Het
Lpin2 A G 17: 71,553,929 (GRCm39) D882G probably benign Het
Lrp1b A T 2: 41,388,233 (GRCm39) F464Y probably benign Het
Musk G A 4: 58,373,583 (GRCm39) C836Y probably damaging Het
Mx1 C T 16: 97,255,406 (GRCm39) D216N probably damaging Het
Ndrg3 A T 2: 156,770,698 (GRCm39) N350K probably benign Het
Oas3 G A 5: 120,895,019 (GRCm39) P990L probably damaging Het
Or4c111 T A 2: 88,844,399 (GRCm39) N3I probably damaging Het
Or4c12b T C 2: 89,647,557 (GRCm39) S296P possibly damaging Het
Or6c2 A G 10: 129,362,357 (GRCm39) D87G probably damaging Het
Otoa T C 7: 120,721,092 (GRCm39) L369P probably damaging Het
Plcg2 A G 8: 118,231,088 (GRCm39) T57A probably damaging Het
Prune2 A T 19: 17,098,755 (GRCm39) T1420S possibly damaging Het
Ptpdc1 A G 13: 48,743,798 (GRCm39) F201S probably damaging Het
Rnf214 A G 9: 45,777,916 (GRCm39) V630A probably damaging Het
Rxrb T A 17: 34,254,718 (GRCm39) I181N probably damaging Het
Scrib T C 15: 75,939,581 (GRCm39) N69S probably damaging Het
Scyl2 A G 10: 89,476,681 (GRCm39) S815P probably benign Het
Sgcd A G 11: 47,246,028 (GRCm39) V58A probably damaging Het
Slc13a3 C T 2: 165,266,543 (GRCm39) V374I probably benign Het
Slc22a4 A T 11: 53,888,341 (GRCm39) I229N probably benign Het
Sohlh1 A G 2: 25,734,679 (GRCm39) S205P possibly damaging Het
Spata20 T C 11: 94,374,444 (GRCm39) M308V probably damaging Het
Stag3 T G 5: 138,297,100 (GRCm39) I550R probably damaging Het
Tac2 A G 10: 127,561,971 (GRCm39) E25G possibly damaging Het
Tars2 T C 3: 95,654,964 (GRCm39) probably null Het
Tefm G A 11: 80,031,057 (GRCm39) R60C probably damaging Het
Trem3 T C 17: 48,565,483 (GRCm39) V179A probably benign Het
Trim37 G T 11: 87,092,266 (GRCm39) D692Y probably damaging Het
Trpc4ap T C 2: 155,508,133 (GRCm39) T173A probably benign Het
Unc13c C T 9: 73,600,486 (GRCm39) probably null Het
Usp18 A G 6: 121,238,456 (GRCm39) K201R probably benign Het
Usp35 T A 7: 96,962,284 (GRCm39) Y524F probably damaging Het
Usp53 A G 3: 122,752,734 (GRCm39) F208L probably damaging Het
Vmn1r80 A T 7: 11,927,654 (GRCm39) I255F probably damaging Het
Vstm2a A T 11: 16,211,483 (GRCm39) I98F probably benign Het
Wdfy4 T A 14: 32,855,317 (GRCm39) I766F possibly damaging Het
Wdr17 T A 8: 55,149,335 (GRCm39) Y55F probably damaging Het
Xpot T C 10: 121,449,551 (GRCm39) K172R probably damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 153,968,576 (GRCm39) missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 153,968,554 (GRCm39) missense probably benign 0.00
IGL02219:Slc44a5 APN 3 153,944,796 (GRCm39) missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 153,956,608 (GRCm39) missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 153,962,156 (GRCm39) missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 153,962,213 (GRCm39) missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 153,956,651 (GRCm39) missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 153,956,714 (GRCm39) missense probably benign 0.15
IGL03144:Slc44a5 APN 3 153,949,177 (GRCm39) missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 153,964,659 (GRCm39) missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 153,945,907 (GRCm39) splice site probably benign
R0190:Slc44a5 UTSW 3 153,944,755 (GRCm39) missense probably null 0.00
R0306:Slc44a5 UTSW 3 153,975,638 (GRCm39) missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 153,939,782 (GRCm39) splice site probably benign
R0744:Slc44a5 UTSW 3 153,971,111 (GRCm39) missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 153,971,111 (GRCm39) missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 153,949,223 (GRCm39) missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 153,963,357 (GRCm39) splice site probably null
R1370:Slc44a5 UTSW 3 153,948,796 (GRCm39) missense probably benign 0.26
R1613:Slc44a5 UTSW 3 153,963,351 (GRCm39) splice site probably null
R1713:Slc44a5 UTSW 3 153,944,743 (GRCm39) missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 153,964,130 (GRCm39) missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 153,964,086 (GRCm39) missense probably benign 0.01
R2293:Slc44a5 UTSW 3 153,945,934 (GRCm39) missense probably benign 0.01
R2367:Slc44a5 UTSW 3 153,953,446 (GRCm39) missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 153,967,031 (GRCm39) splice site probably benign
R3953:Slc44a5 UTSW 3 153,877,209 (GRCm39) missense probably benign 0.03
R4163:Slc44a5 UTSW 3 153,967,010 (GRCm39) missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 153,939,710 (GRCm39) missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 153,962,221 (GRCm39) missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 153,959,353 (GRCm39) missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 153,949,252 (GRCm39) critical splice donor site probably null
R5083:Slc44a5 UTSW 3 153,953,424 (GRCm39) missense probably benign 0.31
R5257:Slc44a5 UTSW 3 153,948,760 (GRCm39) missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 153,966,922 (GRCm39) missense probably benign 0.03
R5586:Slc44a5 UTSW 3 153,975,802 (GRCm39) utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 153,964,029 (GRCm39) missense possibly damaging 0.78
R6228:Slc44a5 UTSW 3 153,944,800 (GRCm39) missense probably benign 0.00
R6248:Slc44a5 UTSW 3 153,969,678 (GRCm39) missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 153,963,387 (GRCm39) missense probably benign 0.21
R6454:Slc44a5 UTSW 3 153,948,796 (GRCm39) missense probably benign 0.26
R6594:Slc44a5 UTSW 3 153,964,660 (GRCm39) missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 153,945,714 (GRCm39) splice site probably null
R6931:Slc44a5 UTSW 3 153,964,143 (GRCm39) missense probably benign 0.03
R7027:Slc44a5 UTSW 3 153,959,356 (GRCm39) missense probably benign 0.00
R7566:Slc44a5 UTSW 3 153,975,626 (GRCm39) missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153,679,437 (GRCm39) critical splice donor site probably null
R8011:Slc44a5 UTSW 3 153,953,447 (GRCm39) missense possibly damaging 0.71
R8085:Slc44a5 UTSW 3 153,928,414 (GRCm39) missense probably damaging 1.00
R8460:Slc44a5 UTSW 3 153,975,667 (GRCm39) missense probably benign 0.00
R8765:Slc44a5 UTSW 3 153,968,561 (GRCm39) missense probably damaging 0.99
R9154:Slc44a5 UTSW 3 153,953,373 (GRCm39) missense probably benign 0.08
R9291:Slc44a5 UTSW 3 153,962,218 (GRCm39) missense possibly damaging 0.82
R9328:Slc44a5 UTSW 3 153,964,678 (GRCm39) missense probably benign 0.37
R9647:Slc44a5 UTSW 3 153,953,370 (GRCm39) missense possibly damaging 0.89
R9666:Slc44a5 UTSW 3 153,945,926 (GRCm39) missense probably benign 0.03
R9695:Slc44a5 UTSW 3 153,956,588 (GRCm39) missense probably damaging 0.99
R9758:Slc44a5 UTSW 3 153,959,322 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACCTAAGGCTTGCTTCTGC -3'
(R):5'- TCTGTTCCTGAGCAGCAAG -3'

Sequencing Primer
(F):5'- GCTTCTGCTTCTTAACGGATAAAC -3'
(R):5'- TTCCTGAGCAGCAAGGTGGAC -3'
Posted On 2017-02-15