Mutagenetix > Incidental Mutations

Incidental Mutation 'R0558:Dnajc13'

45737

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

038750-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R0558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 104201952 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

probably null
Transcript: ENSMUST00000035170

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185503

Predicted Effect

probably null
Transcript: ENSMUST00000186788

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189103

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	T	C	17: 25,947,549	N338S	probably benign	Het
Abcc2	G	A	19: 43,800,724	G273R	probably benign	Het
Adamts10	T	C	17: 33,550,609	V935A	probably benign	Het
Anapc15-ps	T	C	10: 95,673,121	D90G	probably damaging	Het
Atic	T	A	1: 71,563,788	V107E	probably benign	Het
Atp4b	T	C	8: 13,393,523	T52A	possibly damaging	Het
Cacna1h	C	T	17: 25,381,550	A1606T	probably damaging	Het
Cacng6	T	A	7: 3,434,808	Y217*	probably null	Het
Cc2d2a	T	G	5: 43,724,387		probably benign	Het
Cd226	T	A	18: 89,207,214	H78Q	probably benign	Het
Cers3	A	G	7: 66,783,418	D161G	probably damaging	Het
Ces1f	T	C	8: 93,275,389	H37R	probably benign	Het
Chek1	T	A	9: 36,712,115	N421I	possibly damaging	Het
Cma2	T	C	14: 55,972,792	Y45H	probably damaging	Het
Cmas	C	A	6: 142,775,244	Y401*	probably null	Het
Cyp2j8	A	T	4: 96,444,634	S492T	probably benign	Het
Dnah12	T	C	14: 26,709,310	S358P	probably benign	Het
Ep400	A	C	5: 110,685,067		probably benign	Het
Fam209	T	A	2: 172,472,838	N82K	probably benign	Het
Fam92a	T	C	4: 12,164,095	D248G	probably damaging	Het
G3bp2	A	T	5: 92,073,197	Y20N	probably damaging	Het
Gli2	T	C	1: 118,837,649	D924G	probably benign	Het
Gm10787	T	C	10: 77,022,016		noncoding transcript	Het
Gm11568	A	G	11: 99,858,046	R26G	unknown	Het
Gm4788	A	G	1: 139,739,492	V376A	probably damaging	Het
Hivep3	T	G	4: 120,096,566	L693R	probably damaging	Het
Hook1	A	G	4: 95,993,212		probably benign	Het
Ibtk	A	C	9: 85,737,538	D116E	probably damaging	Het
Insrr	C	T	3: 87,810,981	T927I	possibly damaging	Het
Irx1	T	G	13: 71,959,628	S312R	probably benign	Het
Itga11	T	C	9: 62,752,288	Y441H	probably benign	Het
Itsn1	A	G	16: 91,899,623	D38G	possibly damaging	Het
Kat6b	G	T	14: 21,669,421	E1280D	probably benign	Het
Kcnk10	T	A	12: 98,436,301	Y293F	possibly damaging	Het
Krt74	T	A	15: 101,760,963		noncoding transcript	Het
Lars	T	G	18: 42,214,837	I974L	probably benign	Het
Limch1	A	G	5: 66,969,155	D42G	probably damaging	Het
Mau2	G	C	8: 70,042,432	T85R	probably damaging	Het
Mkrn3	A	G	7: 62,418,864	I393T	probably benign	Het
Mpl	A	C	4: 118,444,020	S541R	probably damaging	Het
Nfrkb	T	C	9: 31,410,268	S754P	possibly damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1233	A	G	2: 89,340,236	L22P	probably benign	Het
Olfr1350	T	C	7: 6,570,653	Y221H	possibly damaging	Het
Olfr1537	T	A	9: 39,238,200	T75S	probably damaging	Het
P2rx7	A	T	5: 122,673,798	I391F	possibly damaging	Het
Pbrm1	T	A	14: 31,085,059		probably null	Het
Pcdh8	T	C	14: 79,770,076	D349G	probably damaging	Het
Pias1	A	G	9: 62,882,009	S639P	possibly damaging	Het
Pkhd1l1	A	T	15: 44,484,424	I232F	probably damaging	Het
Plxnc1	C	T	10: 94,837,935	R995Q	probably damaging	Het
Pnliprp2	T	A	19: 58,774,087	S375T	probably benign	Het
Prkar1b	C	T	5: 139,020,092	V313M	probably benign	Het
Ptpn13	T	C	5: 103,529,717	S734P	probably damaging	Het
Rdh1	T	C	10: 127,759,941	W2R	possibly damaging	Het
Rsph10b	A	T	5: 143,949,338	I285L	probably benign	Het
Rubcnl	T	C	14: 75,047,547	F502S	probably damaging	Het
Ryr2	T	A	13: 11,638,443	I3693F	probably damaging	Het
Ryr2	T	C	13: 11,799,861	Y675C	probably damaging	Het
Scaper	T	C	9: 55,685,923	T477A	probably benign	Het
Scn2a	G	T	2: 65,711,925	V791L	probably benign	Het
Sdk1	A	T	5: 142,132,065	T1573S	probably damaging	Het
Sema3c	A	T	5: 17,714,415	H483L	probably benign	Het
Sema6c	T	C	3: 95,168,691	S219P	probably damaging	Het
Slc10a5	T	G	3: 10,335,117	E161A	probably damaging	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc34a3	C	T	2: 25,233,065		probably benign	Het
Slc38a9	A	T	13: 112,729,196		probably null	Het
Taok1	A	C	11: 77,559,844	S367R	possibly damaging	Het
Tlr6	G	A	5: 64,954,860	Q235*	probably null	Het
Top2a	A	G	11: 98,996,839	V1281A	probably benign	Het
Tpgs1	T	C	10: 79,675,782	Y253H	probably damaging	Het
Tubgcp3	T	C	8: 12,653,462	T288A	probably benign	Het
Ubr4	A	G	4: 139,426,902	E2140G	probably benign	Het
Uso1	A	G	5: 92,174,019	Q257R	probably benign	Het
Zfp106	A	G	2: 120,532,196	V48A	probably damaging	Het
Zfp174	T	A	16: 3,848,254	S128T	possibly damaging	Het
Zscan26	T	A	13: 21,445,055	D426V	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGACTCACAGGGAATACTGTACC -3'
(R):5'- GCAGTGCTACAAATCCGCATGTAAAG -3'

Sequencing Primer
(F):5'- CAGTGACTCATAGGGAATACTGTACC -3'
(R):5'- TCCGCATGTAAAGTAAAACCCTG -3'

Posted On

2013-06-11