Incidental Mutation 'R5894:Cog2'
ID 457383
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Name component of oligomeric golgi complex 2
Synonyms Cog2, 1190002B08Rik, 2700012E02Rik
MMRRC Submission 043238-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5894 (G1)
Quality Score 177
Status Not validated
Chromosome 8
Chromosomal Location 125247506-125278747 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125272006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 507 (Y507H)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
AlphaFold Q921L5
Predicted Effect probably benign
Transcript: ENSMUST00000034460
AA Change: Y507H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: Y507H

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,356,680 (GRCm39) E76V probably benign Het
Adcy2 A T 13: 68,773,971 (GRCm39) I1024N probably damaging Het
Agr2 A C 12: 36,045,509 (GRCm39) probably benign Het
Alpk2 T A 18: 65,414,143 (GRCm39) H1991L probably damaging Het
Amotl2 T A 9: 102,602,371 (GRCm39) M448K possibly damaging Het
Ankhd1 T A 18: 36,780,577 (GRCm39) F1876L probably damaging Het
Arl14 T C 3: 69,130,009 (GRCm39) V52A probably benign Het
Atp6v1b2 T A 8: 69,560,218 (GRCm39) probably null Het
Bmal2 A G 6: 146,724,732 (GRCm39) T409A possibly damaging Het
Bpifb4 G A 2: 153,782,852 (GRCm39) R19H possibly damaging Het
Cdh9 T A 15: 16,832,186 (GRCm39) L358I possibly damaging Het
Ces2h T G 8: 105,745,658 (GRCm39) I460M probably benign Het
Crlf3 T A 11: 79,948,678 (GRCm39) R256W probably damaging Het
Csdc2 T A 15: 81,832,881 (GRCm39) F96I probably damaging Het
Csk A C 9: 57,535,958 (GRCm39) I264S probably damaging Het
Cyp2c29 G C 19: 39,318,833 (GRCm39) A438P possibly damaging Het
Ddx43 G A 9: 78,324,016 (GRCm39) G449D probably damaging Het
Fbxw18 G T 9: 109,529,235 (GRCm39) A106E possibly damaging Het
Fchsd2 C T 7: 100,840,959 (GRCm39) T156I probably benign Het
Frs2 T A 10: 116,917,011 (GRCm39) probably benign Het
Gm57858 C T 3: 36,074,124 (GRCm39) E342K possibly damaging Het
Grid2ip A T 5: 143,374,666 (GRCm39) T922S probably damaging Het
Grm1 A G 10: 10,955,999 (GRCm39) L95P probably damaging Het
Ift140 T C 17: 25,252,893 (GRCm39) V348A possibly damaging Het
Insr A G 8: 3,224,869 (GRCm39) S200P possibly damaging Het
Ints12 A T 3: 132,804,319 (GRCm39) D102V probably damaging Het
Kank1 A G 19: 25,401,564 (GRCm39) D1057G probably damaging Het
Kng1 T A 16: 22,892,113 (GRCm39) D225E probably benign Het
Lama1 A T 17: 68,086,042 (GRCm39) probably null Het
Lpin2 A G 17: 71,553,929 (GRCm39) D882G probably benign Het
Lrp1b A T 2: 41,388,233 (GRCm39) F464Y probably benign Het
Musk G A 4: 58,373,583 (GRCm39) C836Y probably damaging Het
Mx1 C T 16: 97,255,406 (GRCm39) D216N probably damaging Het
Ndrg3 A T 2: 156,770,698 (GRCm39) N350K probably benign Het
Oas3 G A 5: 120,895,019 (GRCm39) P990L probably damaging Het
Or4c111 T A 2: 88,844,399 (GRCm39) N3I probably damaging Het
Or4c12b T C 2: 89,647,557 (GRCm39) S296P possibly damaging Het
Or6c2 A G 10: 129,362,357 (GRCm39) D87G probably damaging Het
Otoa T C 7: 120,721,092 (GRCm39) L369P probably damaging Het
Plcg2 A G 8: 118,231,088 (GRCm39) T57A probably damaging Het
Prune2 A T 19: 17,098,755 (GRCm39) T1420S possibly damaging Het
Ptpdc1 A G 13: 48,743,798 (GRCm39) F201S probably damaging Het
Rnf214 A G 9: 45,777,916 (GRCm39) V630A probably damaging Het
Rxrb T A 17: 34,254,718 (GRCm39) I181N probably damaging Het
Scrib T C 15: 75,939,581 (GRCm39) N69S probably damaging Het
Scyl2 A G 10: 89,476,681 (GRCm39) S815P probably benign Het
Sgcd A G 11: 47,246,028 (GRCm39) V58A probably damaging Het
Slc13a3 C T 2: 165,266,543 (GRCm39) V374I probably benign Het
Slc22a4 A T 11: 53,888,341 (GRCm39) I229N probably benign Het
Slc44a5 A G 3: 153,962,210 (GRCm39) Y381C probably damaging Het
Sohlh1 A G 2: 25,734,679 (GRCm39) S205P possibly damaging Het
Spata20 T C 11: 94,374,444 (GRCm39) M308V probably damaging Het
Stag3 T G 5: 138,297,100 (GRCm39) I550R probably damaging Het
Tac2 A G 10: 127,561,971 (GRCm39) E25G possibly damaging Het
Tars2 T C 3: 95,654,964 (GRCm39) probably null Het
Tefm G A 11: 80,031,057 (GRCm39) R60C probably damaging Het
Trem3 T C 17: 48,565,483 (GRCm39) V179A probably benign Het
Trim37 G T 11: 87,092,266 (GRCm39) D692Y probably damaging Het
Trpc4ap T C 2: 155,508,133 (GRCm39) T173A probably benign Het
Unc13c C T 9: 73,600,486 (GRCm39) probably null Het
Usp18 A G 6: 121,238,456 (GRCm39) K201R probably benign Het
Usp35 T A 7: 96,962,284 (GRCm39) Y524F probably damaging Het
Usp53 A G 3: 122,752,734 (GRCm39) F208L probably damaging Het
Vmn1r80 A T 7: 11,927,654 (GRCm39) I255F probably damaging Het
Vstm2a A T 11: 16,211,483 (GRCm39) I98F probably benign Het
Wdfy4 T A 14: 32,855,317 (GRCm39) I766F possibly damaging Het
Wdr17 T A 8: 55,149,335 (GRCm39) Y55F probably damaging Het
Xpot T C 10: 121,449,551 (GRCm39) K172R probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 125,271,982 (GRCm39) missense probably benign 0.00
IGL01092:Cog2 APN 8 125,272,019 (GRCm39) missense probably damaging 1.00
IGL01150:Cog2 APN 8 125,269,630 (GRCm39) missense possibly damaging 0.62
IGL02052:Cog2 APN 8 125,269,627 (GRCm39) critical splice acceptor site probably null
IGL02308:Cog2 APN 8 125,259,951 (GRCm39) critical splice acceptor site probably null
IGL02543:Cog2 APN 8 125,256,698 (GRCm39) missense probably benign 0.09
IGL02978:Cog2 APN 8 125,277,075 (GRCm39) missense probably benign
IGL03008:Cog2 APN 8 125,262,131 (GRCm39) splice site probably benign
IGL03144:Cog2 APN 8 125,267,763 (GRCm39) missense probably damaging 0.98
kugge UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
Pelota UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 125,272,010 (GRCm39) missense probably benign 0.22
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0110:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R0436:Cog2 UTSW 8 125,275,253 (GRCm39) splice site probably benign
R0450:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R1365:Cog2 UTSW 8 125,267,713 (GRCm39) missense probably damaging 0.97
R1661:Cog2 UTSW 8 125,269,629 (GRCm39) missense probably benign 0.20
R1698:Cog2 UTSW 8 125,252,422 (GRCm39) missense probably damaging 1.00
R1856:Cog2 UTSW 8 125,278,142 (GRCm39) missense possibly damaging 0.93
R2122:Cog2 UTSW 8 125,255,724 (GRCm39) missense possibly damaging 0.91
R2398:Cog2 UTSW 8 125,256,665 (GRCm39) missense probably benign 0.07
R3855:Cog2 UTSW 8 125,256,742 (GRCm39) critical splice donor site probably null
R4580:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.01
R4803:Cog2 UTSW 8 125,262,190 (GRCm39) missense probably damaging 0.96
R5316:Cog2 UTSW 8 125,255,779 (GRCm39) missense probably benign 0.14
R5346:Cog2 UTSW 8 125,273,370 (GRCm39) missense possibly damaging 0.94
R5394:Cog2 UTSW 8 125,259,268 (GRCm39) missense probably benign 0.00
R5395:Cog2 UTSW 8 125,271,960 (GRCm39) missense probably benign 0.00
R5738:Cog2 UTSW 8 125,272,777 (GRCm39) missense probably benign 0.03
R5861:Cog2 UTSW 8 125,264,617 (GRCm39) missense probably damaging 1.00
R5941:Cog2 UTSW 8 125,272,825 (GRCm39) missense probably benign
R6186:Cog2 UTSW 8 125,273,425 (GRCm39) missense probably damaging 1.00
R6400:Cog2 UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
R6518:Cog2 UTSW 8 125,253,842 (GRCm39) nonsense probably null
R6558:Cog2 UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
R6717:Cog2 UTSW 8 125,252,488 (GRCm39) missense probably damaging 1.00
R6902:Cog2 UTSW 8 125,273,430 (GRCm39) missense probably damaging 1.00
R6914:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R6942:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R7103:Cog2 UTSW 8 125,267,853 (GRCm39) critical splice donor site probably null
R7274:Cog2 UTSW 8 125,262,258 (GRCm39) missense possibly damaging 0.71
R7641:Cog2 UTSW 8 125,264,621 (GRCm39) missense probably damaging 0.96
R7674:Cog2 UTSW 8 125,264,621 (GRCm39) missense probably damaging 0.96
R8559:Cog2 UTSW 8 125,269,647 (GRCm39) missense probably benign 0.25
R9190:Cog2 UTSW 8 125,260,058 (GRCm39) missense probably damaging 1.00
R9307:Cog2 UTSW 8 125,253,837 (GRCm39) critical splice acceptor site probably null
R9629:Cog2 UTSW 8 125,260,125 (GRCm39) missense possibly damaging 0.67
X0026:Cog2 UTSW 8 125,272,759 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TACAAATGCCCCGTGTCTCC -3'
(R):5'- TTCTCCTGAGAGCAAGGAGC -3'

Sequencing Primer
(F):5'- CTCCGAGGGAGTGTTTGATC -3'
(R):5'- CTCGTGACAGCAGGGATCAG -3'
Posted On 2017-02-15