Mutagenetix > Incidental Mutations

Incidental Mutation 'R5894:Grm1'

457391

Institutional Source

Beutler Lab

Gene Symbol

Grm1

Ensembl Gene

ENSMUSG00000019828

Gene Name

glutamate receptor, metabotropic 1

Synonyms

Grm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik

MMRRC Submission

043238-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.438) question?

Stock #

R5894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10686059-11082356 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11080255 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 95 (L95P)

Ref Sequence

ENSEMBL: ENSMUSP00000101190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044306
AA Change: L95P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: L95P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	1.1e-94	PFAM
Pfam:Peripla_BP_6	151	340	1.4e-10	PFAM
Pfam:NCD3G	521	571	5.5e-16	PFAM
Pfam:7tm_3	604	837	2.4e-55	PFAM
low complexity region	969	975	N/A	INTRINSIC
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1013	1033	N/A	INTRINSIC
low complexity region	1071	1088	N/A	INTRINSIC
low complexity region	1093	1109	N/A	INTRINSIC
low complexity region	1126	1136	N/A	INTRINSIC
GluR_Homer-bdg	1149	1199	6.85e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105560
AA Change: L95P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: L95P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105561
AA Change: L95P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: L95P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156826

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	T	A	3: 146,650,925	E76V	probably benign	Het
Adcy2	A	T	13: 68,625,852	I1024N	probably damaging	Het
Agr2	A	C	12: 35,995,510		probably benign	Het
Alpk2	T	A	18: 65,281,072	H1991L	probably damaging	Het
Amotl2	T	A	9: 102,725,172	M448K	possibly damaging	Het
Ankhd1	T	A	18: 36,647,524	F1876L	probably damaging	Het
Arl14	T	C	3: 69,222,676	V52A	probably benign	Het
Arntl2	A	G	6: 146,823,234	T409A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,107,566		probably null	Het
Bpifb4	G	A	2: 153,940,932	R19H	possibly damaging	Het
Ccdc144b	C	T	3: 36,019,975	E342K	possibly damaging	Het
Cdh9	T	A	15: 16,832,100	L358I	possibly damaging	Het
Ces2h	T	G	8: 105,019,026	I460M	probably benign	Het
Cog2	T	C	8: 124,545,267	Y507H	probably benign	Het
Crlf3	T	A	11: 80,057,852	R256W	probably damaging	Het
Csdc2	T	A	15: 81,948,680	F96I	probably damaging	Het
Csk	A	C	9: 57,628,675	I264S	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Ddx43	G	A	9: 78,416,734	G449D	probably damaging	Het
Fbxw18	G	T	9: 109,700,167	A106E	possibly damaging	Het
Fchsd2	C	T	7: 101,191,752	T156I	probably benign	Het
Frs2	T	A	10: 117,081,106		probably benign	Het
Grid2ip	A	T	5: 143,388,911	T922S	probably damaging	Het
Ift140	T	C	17: 25,033,919	V348A	possibly damaging	Het
Insr	A	G	8: 3,174,869	S200P	possibly damaging	Het
Ints12	A	T	3: 133,098,558	D102V	probably damaging	Het
Kank1	A	G	19: 25,424,200	D1057G	probably damaging	Het
Kng1	T	A	16: 23,073,363	D225E	probably benign	Het
Lama1	A	T	17: 67,779,047		probably null	Het
Lpin2	A	G	17: 71,246,934	D882G	probably benign	Het
Lrp1b	A	T	2: 41,498,221	F464Y	probably benign	Het
Musk	G	A	4: 58,373,583	C836Y	probably damaging	Het
Mx1	C	T	16: 97,454,206	D216N	probably damaging	Het
Ndrg3	A	T	2: 156,928,778	N350K	probably benign	Het
Oas3	G	A	5: 120,756,954	P990L	probably damaging	Het
Olfr1216	T	A	2: 89,014,055	N3I	probably damaging	Het
Olfr1255	T	C	2: 89,817,213	S296P	possibly damaging	Het
Olfr791	A	G	10: 129,526,488	D87G	probably damaging	Het
Otoa	T	C	7: 121,121,869	L369P	probably damaging	Het
Plcg2	A	G	8: 117,504,349	T57A	probably damaging	Het
Prune2	A	T	19: 17,121,391	T1420S	possibly damaging	Het
Ptpdc1	A	G	13: 48,590,322	F201S	probably damaging	Het
Rnf214	A	G	9: 45,866,618	V630A	probably damaging	Het
Rxrb	T	A	17: 34,035,744	I181N	probably damaging	Het
Scrib	T	C	15: 76,067,732	N69S	probably damaging	Het
Scyl2	A	G	10: 89,640,819	S815P	probably benign	Het
Sgcd	A	G	11: 47,355,201	V58A	probably damaging	Het
Slc13a3	C	T	2: 165,424,623	V374I	probably benign	Het
Slc22a4	A	T	11: 53,997,515	I229N	probably benign	Het
Slc44a5	A	G	3: 154,256,573	Y381C	probably damaging	Het
Sohlh1	A	G	2: 25,844,667	S205P	possibly damaging	Het
Spata20	T	C	11: 94,483,618	M308V	probably damaging	Het
Stag3	T	G	5: 138,298,838	I550R	probably damaging	Het
Tac2	A	G	10: 127,726,102	E25G	possibly damaging	Het
Tars2	T	C	3: 95,747,652		probably null	Het
Tefm	G	A	11: 80,140,231	R60C	probably damaging	Het
Trem3	T	C	17: 48,258,455	V179A	probably benign	Het
Trim37	G	T	11: 87,201,440	D692Y	probably damaging	Het
Trpc4ap	T	C	2: 155,666,213	T173A	probably benign	Het
Unc13c	C	T	9: 73,693,204		probably null	Het
Usp18	A	G	6: 121,261,497	K201R	probably benign	Het
Usp35	T	A	7: 97,313,077	Y524F	probably damaging	Het
Usp53	A	G	3: 122,959,085	F208L	probably damaging	Het
Vmn1r80	A	T	7: 12,193,727	I255F	probably damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Wdfy4	T	A	14: 33,133,360	I766F	possibly damaging	Het
Wdr17	T	A	8: 54,696,300	Y55F	probably damaging	Het
Xpot	T	C	10: 121,613,646	K172R	probably damaging	Het

Other mutations in Grm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01371:Grm1	APN	10	10720039	missense	probably benign	0.01
IGL02078:Grm1	APN	10	10689610	missense	probably benign	0.02
IGL02156:Grm1	APN	10	10719976	missense	probably damaging	0.99
IGL02476:Grm1	APN	10	10689453	missense	probably benign	0.29
IGL02498:Grm1	APN	10	10719979	missense	probably damaging	1.00
IGL02621:Grm1	APN	10	10689011	nonsense	probably null
IGL03192:Grm1	APN	10	11079916	missense	possibly damaging	0.66
IGL03342:Grm1	APN	10	11079971	missense	probably benign	0.08
dewey	UTSW	10	10719595	missense	probably damaging	1.00
Dingus	UTSW	10	10719967	missense	probably benign	0.06
donald	UTSW	10	10741508	nonsense	probably null
jim	UTSW	10	10719805	missense	probably damaging	1.00
lightness	UTSW	10	11079958	missense	probably damaging	1.00
IGL02796:Grm1	UTSW	10	10689667	missense	probably benign
R0294:Grm1	UTSW	10	11080399	missense	probably damaging	1.00
R0525:Grm1	UTSW	10	10719209	splice site	probably benign
R0554:Grm1	UTSW	10	10719923	missense	probably benign	0.01
R1184:Grm1	UTSW	10	10720034	missense	probably benign	0.40
R1319:Grm1	UTSW	10	10689398	missense	probably benign	0.05
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1494:Grm1	UTSW	10	10689706	missense	probably benign	0.04
R1589:Grm1	UTSW	10	10719967	missense	probably benign	0.06
R1615:Grm1	UTSW	10	10741508	nonsense	probably null
R1720:Grm1	UTSW	10	10746794	splice site	probably null
R1738:Grm1	UTSW	10	10936419	missense	probably damaging	1.00
R1763:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R1774:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R2041:Grm1	UTSW	10	10746603	missense	probably damaging	0.98
R2092:Grm1	UTSW	10	10689225	missense	probably benign	0.00
R2198:Grm1	UTSW	10	10782776	missense	probably damaging	1.00
R2297:Grm1	UTSW	10	11080414	missense	probably benign	0.03
R2333:Grm1	UTSW	10	10719346	missense	probably damaging	0.98
R2333:Grm1	UTSW	10	10719619	missense	probably benign	0.31
R2914:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3105:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3106:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3705:Grm1	UTSW	10	10782729	missense	possibly damaging	0.95
R3931:Grm1	UTSW	10	10719878	missense	probably benign	0.44
R4810:Grm1	UTSW	10	10782694	missense	probably damaging	1.00
R4892:Grm1	UTSW	10	10719587	missense	possibly damaging	0.81
R4938:Grm1	UTSW	10	10936513	missense	probably damaging	1.00
R4947:Grm1	UTSW	10	10782633	missense	probably damaging	1.00
R4966:Grm1	UTSW	10	10719665	nonsense	probably null
R5152:Grm1	UTSW	10	11079875	missense	probably benign	0.13
R5283:Grm1	UTSW	10	10733192	missense	possibly damaging	0.70
R5317:Grm1	UTSW	10	10746699	missense	possibly damaging	0.77
R5374:Grm1	UTSW	10	11080442	missense	probably benign	0.14
R5428:Grm1	UTSW	10	10719563	missense	probably damaging	1.00
R5604:Grm1	UTSW	10	10746735	missense	probably damaging	1.00
R5896:Grm1	UTSW	10	11080550	utr 5 prime	probably benign
R5899:Grm1	UTSW	10	10689348	missense	probably benign
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6139:Grm1	UTSW	10	10746331	intron	probably benign
R6144:Grm1	UTSW	10	11079896	missense	probably benign	0.08
R6208:Grm1	UTSW	10	10719946	missense	probably damaging	1.00
R6976:Grm1	UTSW	10	10689180	missense	probably benign	0.00
R7027:Grm1	UTSW	10	10719595	missense	probably damaging	1.00
R7079:Grm1	UTSW	10	11079958	missense	probably damaging	1.00
R7286:Grm1	UTSW	10	10689696	missense	probably benign	0.19
R7352:Grm1	UTSW	10	10719493	missense	probably damaging	1.00
R7484:Grm1	UTSW	10	10746659	missense	probably benign	0.06
R7838:Grm1	UTSW	10	11080352	missense	probably benign	0.02
R8108:Grm1	UTSW	10	10720132	missense	probably benign	0.01
R8379:Grm1	UTSW	10	10689135	missense	possibly damaging	0.86
R8498:Grm1	UTSW	10	11079861	nonsense	probably null
R8712:Grm1	UTSW	10	10689552	missense	probably benign	0.34
X0002:Grm1	UTSW	10	10936513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATAGGCTTCTTAGTCCTGCC -3'
(R):5'- TGACAGAAAAGTACTGCTGGC -3'

Sequencing Primer
(F):5'- CTTCTTAGTCCTGCCTGGGG -3'
(R):5'- TCGTCCCAGCGCTCTGTG -3'

Posted On

2017-02-15