Incidental Mutation 'R5894:Scyl2'
ID457393
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene NameSCY1-like 2 (S. cerevisiae)
SynonymsCVAK104, D10Ertd802e
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89638721-89686285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89640819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 815 (S815P)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]
Predicted Effect probably benign
Transcript: ENSMUST00000092227
AA Change: S814P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: S814P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105294
Predicted Effect probably benign
Transcript: ENSMUST00000174252
AA Change: S815P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: S815P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89657809 critical splice donor site probably null
IGL01141:Scyl2 APN 10 89640635 missense probably benign
IGL01597:Scyl2 APN 10 89652987 missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89654225 missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89657938 splice site probably benign
IGL02466:Scyl2 APN 10 89653009 nonsense probably null
IGL02511:Scyl2 APN 10 89640819 missense probably benign
IGL02949:Scyl2 APN 10 89660301 missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89652968 missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89657867 missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89650080 missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89659321 missense probably benign 0.44
R0827:Scyl2 UTSW 10 89657865 missense possibly damaging 0.91
R1394:Scyl2 UTSW 10 89640965 missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89657889 missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89650956 missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89640736 missense probably benign 0.19
R1909:Scyl2 UTSW 10 89640905 missense probably benign 0.01
R3846:Scyl2 UTSW 10 89640541 missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89650052 missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4079:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4765:Scyl2 UTSW 10 89659298 missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89640463 utr 3 prime probably benign
R5308:Scyl2 UTSW 10 89642007 missense probably benign 0.01
R5901:Scyl2 UTSW 10 89660262 missense probably benign 0.03
R6048:Scyl2 UTSW 10 89645486 missense probably benign 0.33
R6249:Scyl2 UTSW 10 89657857 missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89640973 missense probably benign 0.01
R6827:Scyl2 UTSW 10 89669804 critical splice acceptor site probably null
R6909:Scyl2 UTSW 10 89645742 missense probably benign 0.28
R7027:Scyl2 UTSW 10 89645461 critical splice donor site probably null
R7095:Scyl2 UTSW 10 89669687 missense probably damaging 1.00
R8062:Scyl2 UTSW 10 89654160 missense probably damaging 0.97
Z1177:Scyl2 UTSW 10 89669715 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGGTGCAAACTGATTCAGCC -3'
(R):5'- ACCAGCCTTTCTGTTAGCAC -3'

Sequencing Primer
(F):5'- ACTGATTCAGCCACTGATTTGG -3'
(R):5'- CGGCATGATGTTTTCAACACC -3'
Posted On2017-02-15