Incidental Mutation 'R5894:Tac2'
ID457396
Institutional Source Beutler Lab
Gene Symbol Tac2
Ensembl Gene ENSMUSG00000025400
Gene Nametachykinin 2
Synonymsneuropeptide K, substance K, neurokinin 2, neuromedin L, neurokinin alpha, neurokinin A
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5894 (G1)
Quality Score189
Status Not validated
Chromosome10
Chromosomal Location127724478-127731768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127726102 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 25 (E25G)
Ref Sequence ENSEMBL: ENSMUSP00000136622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026466] [ENSMUST00000179960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026466
AA Change: E25G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026466
Gene: ENSMUSG00000025400
AA Change: E25G

DomainStartEndE-ValueType
Pfam:Neurokinin_B 1 55 3.1e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179960
AA Change: E25G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136622
Gene: ENSMUSG00000025400
AA Change: E25G

DomainStartEndE-ValueType
Pfam:Neurokinin_B 1 54 2.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tachykinin family of signaling peptides that is widely expressed in the central nervous system and plays a role in diverse processes such as water homeostasis, pulmonary inflammation, cognition, fear memory consolidation and preeclampsia. The encoded protein is enzymatically processed to generate the mature neuropeptide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed female sexual maturation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Tac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tac2 APN 10 127726134 critical splice donor site probably null
IGL01552:Tac2 APN 10 127726101 missense possibly damaging 0.80
R0465:Tac2 UTSW 10 127729170 splice site probably benign
R1130:Tac2 UTSW 10 127729502 missense possibly damaging 0.67
R1956:Tac2 UTSW 10 127728480 splice site probably null
R1957:Tac2 UTSW 10 127728480 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACGCTCTTGAGATCAGGGC -3'
(R):5'- TACCCTGGAGACAAGATGGAC -3'

Sequencing Primer
(F):5'- CTCTTGAGATCAGGGCTCAGATAG -3'
(R):5'- CCTGGAGACAAGATGGACACAGG -3'
Posted On2017-02-15