Mutagenetix > Incidental Mutations

Incidental Mutation 'R5894:Slc22a4'

457401

Institutional Source

Beutler Lab

Gene Symbol

Slc22a4

Ensembl Gene

ENSMUSG00000020334

Gene Name

solute carrier family 22 (organic cation transporter), member 4

Synonyms

Octn1

MMRRC Submission

043238-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.397) question?

Stock #

R5894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53983123-54028090 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53997515 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 229 (I229N)

Ref Sequence

ENSEMBL: ENSMUSP00000020586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020586]

Predicted Effect

probably benign
Transcript: ENSMUST00000020586
AA Change: I229N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: I229N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Sugar_tr	60	524	2.7e-30	PFAM
Pfam:MFS_1	139	478	1.7e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146351

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	T	A	3: 146,650,925	E76V	probably benign	Het
Adcy2	A	T	13: 68,625,852	I1024N	probably damaging	Het
Agr2	A	C	12: 35,995,510		probably benign	Het
Alpk2	T	A	18: 65,281,072	H1991L	probably damaging	Het
Amotl2	T	A	9: 102,725,172	M448K	possibly damaging	Het
Ankhd1	T	A	18: 36,647,524	F1876L	probably damaging	Het
Arl14	T	C	3: 69,222,676	V52A	probably benign	Het
Arntl2	A	G	6: 146,823,234	T409A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,107,566		probably null	Het
Bpifb4	G	A	2: 153,940,932	R19H	possibly damaging	Het
Ccdc144b	C	T	3: 36,019,975	E342K	possibly damaging	Het
Cdh9	T	A	15: 16,832,100	L358I	possibly damaging	Het
Ces2h	T	G	8: 105,019,026	I460M	probably benign	Het
Cog2	T	C	8: 124,545,267	Y507H	probably benign	Het
Crlf3	T	A	11: 80,057,852	R256W	probably damaging	Het
Csdc2	T	A	15: 81,948,680	F96I	probably damaging	Het
Csk	A	C	9: 57,628,675	I264S	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Ddx43	G	A	9: 78,416,734	G449D	probably damaging	Het
Fbxw18	G	T	9: 109,700,167	A106E	possibly damaging	Het
Fchsd2	C	T	7: 101,191,752	T156I	probably benign	Het
Frs2	T	A	10: 117,081,106		probably benign	Het
Grid2ip	A	T	5: 143,388,911	T922S	probably damaging	Het
Grm1	A	G	10: 11,080,255	L95P	probably damaging	Het
Ift140	T	C	17: 25,033,919	V348A	possibly damaging	Het
Insr	A	G	8: 3,174,869	S200P	possibly damaging	Het
Ints12	A	T	3: 133,098,558	D102V	probably damaging	Het
Kank1	A	G	19: 25,424,200	D1057G	probably damaging	Het
Kng1	T	A	16: 23,073,363	D225E	probably benign	Het
Lama1	A	T	17: 67,779,047		probably null	Het
Lpin2	A	G	17: 71,246,934	D882G	probably benign	Het
Lrp1b	A	T	2: 41,498,221	F464Y	probably benign	Het
Musk	G	A	4: 58,373,583	C836Y	probably damaging	Het
Mx1	C	T	16: 97,454,206	D216N	probably damaging	Het
Ndrg3	A	T	2: 156,928,778	N350K	probably benign	Het
Oas3	G	A	5: 120,756,954	P990L	probably damaging	Het
Olfr1216	T	A	2: 89,014,055	N3I	probably damaging	Het
Olfr1255	T	C	2: 89,817,213	S296P	possibly damaging	Het
Olfr791	A	G	10: 129,526,488	D87G	probably damaging	Het
Otoa	T	C	7: 121,121,869	L369P	probably damaging	Het
Plcg2	A	G	8: 117,504,349	T57A	probably damaging	Het
Prune2	A	T	19: 17,121,391	T1420S	possibly damaging	Het
Ptpdc1	A	G	13: 48,590,322	F201S	probably damaging	Het
Rnf214	A	G	9: 45,866,618	V630A	probably damaging	Het
Rxrb	T	A	17: 34,035,744	I181N	probably damaging	Het
Scrib	T	C	15: 76,067,732	N69S	probably damaging	Het
Scyl2	A	G	10: 89,640,819	S815P	probably benign	Het
Sgcd	A	G	11: 47,355,201	V58A	probably damaging	Het
Slc13a3	C	T	2: 165,424,623	V374I	probably benign	Het
Slc44a5	A	G	3: 154,256,573	Y381C	probably damaging	Het
Sohlh1	A	G	2: 25,844,667	S205P	possibly damaging	Het
Spata20	T	C	11: 94,483,618	M308V	probably damaging	Het
Stag3	T	G	5: 138,298,838	I550R	probably damaging	Het
Tac2	A	G	10: 127,726,102	E25G	possibly damaging	Het
Tars2	T	C	3: 95,747,652		probably null	Het
Tefm	G	A	11: 80,140,231	R60C	probably damaging	Het
Trem3	T	C	17: 48,258,455	V179A	probably benign	Het
Trim37	G	T	11: 87,201,440	D692Y	probably damaging	Het
Trpc4ap	T	C	2: 155,666,213	T173A	probably benign	Het
Unc13c	C	T	9: 73,693,204		probably null	Het
Usp18	A	G	6: 121,261,497	K201R	probably benign	Het
Usp35	T	A	7: 97,313,077	Y524F	probably damaging	Het
Usp53	A	G	3: 122,959,085	F208L	probably damaging	Het
Vmn1r80	A	T	7: 12,193,727	I255F	probably damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Wdfy4	T	A	14: 33,133,360	I766F	possibly damaging	Het
Wdr17	T	A	8: 54,696,300	Y55F	probably damaging	Het
Xpot	T	C	10: 121,613,646	K172R	probably damaging	Het

Other mutations in Slc22a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01459:Slc22a4	APN	11	53986477	critical splice donor site	probably null
IGL01723:Slc22a4	APN	11	53988845	missense	probably benign	0.28
IGL01839:Slc22a4	APN	11	53996077	missense	probably damaging	0.98
IGL02022:Slc22a4	APN	11	53983609	unclassified	probably benign
IGL02386:Slc22a4	APN	11	53988772	splice site	probably benign
PIT1430001:Slc22a4	UTSW	11	54027957	missense	probably benign
R0001:Slc22a4	UTSW	11	54028003	start gained	probably benign
R1111:Slc22a4	UTSW	11	54007841	missense	probably benign
R1710:Slc22a4	UTSW	11	54027975	start codon destroyed	probably null	0.99
R2104:Slc22a4	UTSW	11	53983610	unclassified	probably benign
R3081:Slc22a4	UTSW	11	54007789	missense	probably benign	0.38
R3498:Slc22a4	UTSW	11	53992053	missense	probably benign	0.00
R4014:Slc22a4	UTSW	11	53997392	missense	probably benign	0.04
R4658:Slc22a4	UTSW	11	53997510	missense	probably benign	0.05
R4720:Slc22a4	UTSW	11	53988893	missense	probably damaging	1.00
R4727:Slc22a4	UTSW	11	54027651	missense	possibly damaging	0.83
R5945:Slc22a4	UTSW	11	53996028	missense	probably damaging	1.00
R6295:Slc22a4	UTSW	11	54007808	missense	possibly damaging	0.46
R6848:Slc22a4	UTSW	11	54007789	missense	possibly damaging	0.90
R6899:Slc22a4	UTSW	11	53988913	missense	probably damaging	1.00
R7343:Slc22a4	UTSW	11	53986538	missense	possibly damaging	0.53
R7414:Slc22a4	UTSW	11	53997428	missense	probably benign	0.00
R7806:Slc22a4	UTSW	11	53990650	missense	probably damaging	1.00
R8068:Slc22a4	UTSW	11	53997443	missense	possibly damaging	0.89
Z1177:Slc22a4	UTSW	11	54027718	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACAGTGGGCTCATCTCTGG -3'
(R):5'- CTCTGAAAACAGCATTGTCAGAAGG -3'

Sequencing Primer
(F):5'- GCTCATCTCTGGAGTGCCTG -3'
(R):5'- CAGCATTGTCAGAAGGCAGTAGTTTC -3'

Posted On

2017-02-15