Incidental Mutation 'R5894:Slc22a4'
ID457401
Institutional Source Beutler Lab
Gene Symbol Slc22a4
Ensembl Gene ENSMUSG00000020334
Gene Namesolute carrier family 22 (organic cation transporter), member 4
SynonymsOctn1
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53983123-54028090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53997515 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 229 (I229N)
Ref Sequence ENSEMBL: ENSMUSP00000020586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586]
Predicted Effect probably benign
Transcript: ENSMUST00000020586
AA Change: I229N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: I229N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146351
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Slc22a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Slc22a4 APN 11 53986477 critical splice donor site probably null
IGL01723:Slc22a4 APN 11 53988845 missense probably benign 0.28
IGL01839:Slc22a4 APN 11 53996077 missense probably damaging 0.98
IGL02022:Slc22a4 APN 11 53983609 unclassified probably benign
IGL02386:Slc22a4 APN 11 53988772 splice site probably benign
PIT1430001:Slc22a4 UTSW 11 54027957 missense probably benign
R0001:Slc22a4 UTSW 11 54028003 start gained probably benign
R1111:Slc22a4 UTSW 11 54007841 missense probably benign
R1710:Slc22a4 UTSW 11 54027975 start codon destroyed probably null 0.99
R2104:Slc22a4 UTSW 11 53983610 unclassified probably benign
R3081:Slc22a4 UTSW 11 54007789 missense probably benign 0.38
R3498:Slc22a4 UTSW 11 53992053 missense probably benign 0.00
R4014:Slc22a4 UTSW 11 53997392 missense probably benign 0.04
R4658:Slc22a4 UTSW 11 53997510 missense probably benign 0.05
R4720:Slc22a4 UTSW 11 53988893 missense probably damaging 1.00
R4727:Slc22a4 UTSW 11 54027651 missense possibly damaging 0.83
R5945:Slc22a4 UTSW 11 53996028 missense probably damaging 1.00
R6295:Slc22a4 UTSW 11 54007808 missense possibly damaging 0.46
R6848:Slc22a4 UTSW 11 54007789 missense possibly damaging 0.90
R6899:Slc22a4 UTSW 11 53988913 missense probably damaging 1.00
R7343:Slc22a4 UTSW 11 53986538 missense possibly damaging 0.53
R7414:Slc22a4 UTSW 11 53997428 missense probably benign 0.00
R7806:Slc22a4 UTSW 11 53990650 missense probably damaging 1.00
R8068:Slc22a4 UTSW 11 53997443 missense possibly damaging 0.89
R8087:Slc22a4 UTSW 11 53996061 missense possibly damaging 0.80
R8218:Slc22a4 UTSW 11 53986581 missense probably benign 0.00
Z1177:Slc22a4 UTSW 11 54027718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGTGGGCTCATCTCTGG -3'
(R):5'- CTCTGAAAACAGCATTGTCAGAAGG -3'

Sequencing Primer
(F):5'- GCTCATCTCTGGAGTGCCTG -3'
(R):5'- CAGCATTGTCAGAAGGCAGTAGTTTC -3'
Posted On2017-02-15