Incidental Mutation 'R5894:Mx1'
ID457415
Institutional Source Beutler Lab
Gene Symbol Mx1
Ensembl Gene ENSMUSG00000000386
Gene NameMX dynamin-like GTPase 1
SynonymsMx-1, Mx, myxovirus (influenza) resistance 1 polypeptide
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5894 (G1)
Quality Score171
Status Not validated
Chromosome16
Chromosomal Location97447035-97462907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97454206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 216 (D216N)
Ref Sequence ENSEMBL: ENSMUSP00000156203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023655] [ENSMUST00000113768] [ENSMUST00000135184] [ENSMUST00000142883] [ENSMUST00000155233] [ENSMUST00000232193] [ENSMUST00000232282]
Predicted Effect probably damaging
Transcript: ENSMUST00000023655
AA Change: D216N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386
AA Change: D216N

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113768
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135184
AA Change: D72N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138813
Gene: ENSMUSG00000000386
AA Change: D72N

DomainStartEndE-ValueType
DYNc 2 111 2.62e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142883
SMART Domains Protein: ENSMUSP00000114709
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
Pfam:Dynamin_N 39 65 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155233
AA Change: D216N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138532
Gene: ENSMUSG00000000386
AA Change: D216N

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231995
Predicted Effect probably benign
Transcript: ENSMUST00000232193
Predicted Effect probably damaging
Transcript: ENSMUST00000232282
AA Change: D216N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Mx protein family of large GTPases, and functions in the innate immunity system. Interferon alpha/beta treatment or viral infection induces expression of this protein, which subsequently accumulates in the cytoplasm and inhibits viral replication. It has been shown to confer resistance to the influenza virus. This gene produces a functional protein in some feral mouse strains, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a deletion or a nonsense mutation that results in a non-functional gene product. [provided by RefSeq, Aug 2015]
PHENOTYPE: A2G, SL/NiA, T9 and CAST/Ei strains produce the MX1 protein (Mx1+ allele) conferring resistance to myxoviruses, whereas no protein is made by the Mx1- susceptible alleles of C57BL/6J and many other inbred strains with an exon 9-11 deletion; or CBA/J, CE/J, I/LnJ and PERA/Ei with a nonsense mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Mx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Mx1 APN 16 97457432 missense probably damaging 1.00
IGL01328:Mx1 APN 16 97455632 missense probably damaging 0.99
IGL03105:Mx1 APN 16 97456354 missense possibly damaging 0.94
PIT4585001:Mx1 UTSW 16 97456254 missense probably benign 0.07
R0003:Mx1 UTSW 16 97451588 intron probably benign
R1597:Mx1 UTSW 16 97455129 missense probably damaging 1.00
R1753:Mx1 UTSW 16 97454158 missense probably damaging 1.00
R1780:Mx1 UTSW 16 97451512 makesense probably null
R1826:Mx1 UTSW 16 97455637 missense possibly damaging 0.95
R1851:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R1852:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R2059:Mx1 UTSW 16 97454179 nonsense probably null
R2223:Mx1 UTSW 16 97455232 splice site probably benign
R3441:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3442:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3782:Mx1 UTSW 16 97451995 missense possibly damaging 0.75
R4460:Mx1 UTSW 16 97454081 missense probably damaging 0.99
R4659:Mx1 UTSW 16 97455239 splice site probably null
R5116:Mx1 UTSW 16 97457479 missense possibly damaging 0.67
R5186:Mx1 UTSW 16 97455494 missense probably benign 0.09
R5215:Mx1 UTSW 16 97448360 missense possibly damaging 0.72
R5249:Mx1 UTSW 16 97457428 missense probably damaging 1.00
R5450:Mx1 UTSW 16 97454147 nonsense probably null
R5806:Mx1 UTSW 16 97454151 missense possibly damaging 0.81
R5916:Mx1 UTSW 16 97451733 missense probably benign 0.00
R5981:Mx1 UTSW 16 97454205 missense probably damaging 1.00
R7111:Mx1 UTSW 16 97455176 missense probably damaging 0.99
R7207:Mx1 UTSW 16 97452198 missense probably benign
R7238:Mx1 UTSW 16 97448296 missense unknown
R7318:Mx1 UTSW 16 97452086 missense probably benign 0.06
R7856:Mx1 UTSW 16 97455535 missense probably damaging 1.00
R7939:Mx1 UTSW 16 97455535 missense probably damaging 1.00
R8012:Mx1 UTSW 16 97457372 missense probably damaging 1.00
X0028:Mx1 UTSW 16 97450421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGATCCTTGAAGAAGACTTGC -3'
(R):5'- ACTGTCTGCCTCAGCCAAAG -3'

Sequencing Primer
(F):5'- GAAGACTTGCTCTTTCTGAAAAGCC -3'
(R):5'- CTTCCAGGTAACAGTCTATCACAGTG -3'
Posted On2017-02-15