Mutagenetix > Incidental Mutations

Incidental Mutation 'R5894:Ift140'

457417

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

043238-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25033919 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 348 (V348A)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024983
AA Change: V348A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: V348A

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137386
AA Change: V348A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: V348A

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156945
AA Change: V79A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: V79A

Domain	Start	End	E-Value	Type
Blast:WD40	2	35	6e-12	BLAST
SCOP:d1erja_	19	131	5e-7	SMART
Blast:WD40	39	83	1e-24	BLAST
Blast:WD40	95	136	2e-18	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	T	A	3: 146,650,925	E76V	probably benign	Het
Adcy2	A	T	13: 68,625,852	I1024N	probably damaging	Het
Agr2	A	C	12: 35,995,510		probably benign	Het
Alpk2	T	A	18: 65,281,072	H1991L	probably damaging	Het
Amotl2	T	A	9: 102,725,172	M448K	possibly damaging	Het
Ankhd1	T	A	18: 36,647,524	F1876L	probably damaging	Het
Arl14	T	C	3: 69,222,676	V52A	probably benign	Het
Arntl2	A	G	6: 146,823,234	T409A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,107,566		probably null	Het
Bpifb4	G	A	2: 153,940,932	R19H	possibly damaging	Het
Ccdc144b	C	T	3: 36,019,975	E342K	possibly damaging	Het
Cdh9	T	A	15: 16,832,100	L358I	possibly damaging	Het
Ces2h	T	G	8: 105,019,026	I460M	probably benign	Het
Cog2	T	C	8: 124,545,267	Y507H	probably benign	Het
Crlf3	T	A	11: 80,057,852	R256W	probably damaging	Het
Csdc2	T	A	15: 81,948,680	F96I	probably damaging	Het
Csk	A	C	9: 57,628,675	I264S	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Ddx43	G	A	9: 78,416,734	G449D	probably damaging	Het
Fbxw18	G	T	9: 109,700,167	A106E	possibly damaging	Het
Fchsd2	C	T	7: 101,191,752	T156I	probably benign	Het
Frs2	T	A	10: 117,081,106		probably benign	Het
Grid2ip	A	T	5: 143,388,911	T922S	probably damaging	Het
Grm1	A	G	10: 11,080,255	L95P	probably damaging	Het
Insr	A	G	8: 3,174,869	S200P	possibly damaging	Het
Ints12	A	T	3: 133,098,558	D102V	probably damaging	Het
Kank1	A	G	19: 25,424,200	D1057G	probably damaging	Het
Kng1	T	A	16: 23,073,363	D225E	probably benign	Het
Lama1	A	T	17: 67,779,047		probably null	Het
Lpin2	A	G	17: 71,246,934	D882G	probably benign	Het
Lrp1b	A	T	2: 41,498,221	F464Y	probably benign	Het
Musk	G	A	4: 58,373,583	C836Y	probably damaging	Het
Mx1	C	T	16: 97,454,206	D216N	probably damaging	Het
Ndrg3	A	T	2: 156,928,778	N350K	probably benign	Het
Oas3	G	A	5: 120,756,954	P990L	probably damaging	Het
Olfr1216	T	A	2: 89,014,055	N3I	probably damaging	Het
Olfr1255	T	C	2: 89,817,213	S296P	possibly damaging	Het
Olfr791	A	G	10: 129,526,488	D87G	probably damaging	Het
Otoa	T	C	7: 121,121,869	L369P	probably damaging	Het
Plcg2	A	G	8: 117,504,349	T57A	probably damaging	Het
Prune2	A	T	19: 17,121,391	T1420S	possibly damaging	Het
Ptpdc1	A	G	13: 48,590,322	F201S	probably damaging	Het
Rnf214	A	G	9: 45,866,618	V630A	probably damaging	Het
Rxrb	T	A	17: 34,035,744	I181N	probably damaging	Het
Scrib	T	C	15: 76,067,732	N69S	probably damaging	Het
Scyl2	A	G	10: 89,640,819	S815P	probably benign	Het
Sgcd	A	G	11: 47,355,201	V58A	probably damaging	Het
Slc13a3	C	T	2: 165,424,623	V374I	probably benign	Het
Slc22a4	A	T	11: 53,997,515	I229N	probably benign	Het
Slc44a5	A	G	3: 154,256,573	Y381C	probably damaging	Het
Sohlh1	A	G	2: 25,844,667	S205P	possibly damaging	Het
Spata20	T	C	11: 94,483,618	M308V	probably damaging	Het
Stag3	T	G	5: 138,298,838	I550R	probably damaging	Het
Tac2	A	G	10: 127,726,102	E25G	possibly damaging	Het
Tars2	T	C	3: 95,747,652		probably null	Het
Tefm	G	A	11: 80,140,231	R60C	probably damaging	Het
Trem3	T	C	17: 48,258,455	V179A	probably benign	Het
Trim37	G	T	11: 87,201,440	D692Y	probably damaging	Het
Trpc4ap	T	C	2: 155,666,213	T173A	probably benign	Het
Unc13c	C	T	9: 73,693,204		probably null	Het
Usp18	A	G	6: 121,261,497	K201R	probably benign	Het
Usp35	T	A	7: 97,313,077	Y524F	probably damaging	Het
Usp53	A	G	3: 122,959,085	F208L	probably damaging	Het
Vmn1r80	A	T	7: 12,193,727	I255F	probably damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Wdfy4	T	A	14: 33,133,360	I766F	possibly damaging	Het
Wdr17	T	A	8: 54,696,300	Y55F	probably damaging	Het
Xpot	T	C	10: 121,613,646	K172R	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACACATGCCGACACCATGG -3'
(R):5'- ACCTACACTGAGTAACTGATAAGAC -3'

Sequencing Primer
(F):5'- ATGCCGACACCATGGACAGG -3'
(R):5'- CAAGCTAATTATGTTCTCCGTTTGG -3'

Posted On

2017-02-15