Incidental Mutation 'R5894:Rxrb'
ID457418
Institutional Source Beutler Lab
Gene Symbol Rxrb
Ensembl Gene ENSMUSG00000039656
Gene Nameretinoid X receptor beta
SynonymsNr2b2, Rub, RCoR-1, H-2RIIBP
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34031812-34038393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34035744 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 181 (I181N)
Ref Sequence ENSEMBL: ENSMUSP00000133661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025186] [ENSMUST00000044858] [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000116612] [ENSMUST00000131134] [ENSMUST00000169397] [ENSMUST00000171872] [ENSMUST00000173354] [ENSMUST00000173554]
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044858
AA Change: I291N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656
AA Change: I291N

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087497
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114252
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114255
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116612
AA Change: I181N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656
AA Change: I181N

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect probably benign
Transcript: ENSMUST00000171872
SMART Domains Protein: ENSMUSP00000133146
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 246 4.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173354
AA Change: I181N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656
AA Change: I181N

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173554
SMART Domains Protein: ENSMUSP00000134299
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.9e-11 PFAM
ZnF_C4 79 150 3.98e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174130
Predicted Effect unknown
Transcript: ENSMUST00000174299
AA Change: I229N
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656
AA Change: I229N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174740
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutant mice homozygous for a null mutation exhibit partial embryonic and perinatal lethality, and surviving adult males are sterile due to defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Rxrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Rxrb APN 17 34034075 missense probably damaging 1.00
IGL01337:Rxrb APN 17 34036631 missense probably damaging 1.00
I2505:Rxrb UTSW 17 34033549 splice site probably benign
R0571:Rxrb UTSW 17 34032132 unclassified probably benign
R1463:Rxrb UTSW 17 34034160 missense probably damaging 1.00
R2312:Rxrb UTSW 17 34032129 unclassified probably benign
R2395:Rxrb UTSW 17 34037438 missense probably damaging 1.00
R2935:Rxrb UTSW 17 34032132 unclassified probably benign
R3978:Rxrb UTSW 17 34036326 missense possibly damaging 0.92
R5119:Rxrb UTSW 17 34033588 missense probably benign 0.10
R5523:Rxrb UTSW 17 34036437 missense probably damaging 1.00
R5638:Rxrb UTSW 17 34037407 missense probably damaging 1.00
R5769:Rxrb UTSW 17 34032847 utr 5 prime probably benign
R6373:Rxrb UTSW 17 34033559 missense probably benign 0.08
R7798:Rxrb UTSW 17 34033605 missense probably damaging 1.00
R8087:Rxrb UTSW 17 34035789 missense probably benign 0.00
Z1177:Rxrb UTSW 17 34032127 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCTTTATCTCAAGGGACATTGG -3'
(R):5'- AAGGCCTTTTAGTTCAGTGCAAG -3'

Sequencing Primer
(F):5'- TATCTCAAGGGACATTGGCCCTG -3'
(R):5'- CCTTTTAGTTCAGTGCAAGGTAAG -3'
Posted On2017-02-15