Incidental Mutation 'R5895:Mybpc3'
ID457433
Institutional Source Beutler Lab
Gene Symbol Mybpc3
Ensembl Gene ENSMUSG00000002100
Gene Namemyosin binding protein C, cardiac
Synonymscardiac C-protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R5895 (G1)
Quality Score179
Status Validated
Chromosome2
Chromosomal Location91118144-91136516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91124665 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 481 (V481D)
Ref Sequence ENSEMBL: ENSMUSP00000127070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]
Predicted Effect probably damaging
Transcript: ENSMUST00000111430
AA Change: V480D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100
AA Change: V480D

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137942
AA Change: V316D

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100
AA Change: V316D

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169776
AA Change: V481D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100
AA Change: V481D

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,617 T249A probably benign Het
Abcb1a G A 5: 8,702,216 G426S probably damaging Het
Casp4 A T 9: 5,328,573 probably benign Het
Ccdc40 T A 11: 119,253,403 F988Y probably damaging Het
Chd5 T A 4: 152,379,932 V1516E probably benign Het
Chrnd T A 1: 87,195,667 probably null Het
Col5a3 C A 9: 20,772,442 G1506V unknown Het
Csgalnact2 A T 6: 118,129,254 C34* probably null Het
Ddx23 T C 15: 98,651,951 K195E probably benign Het
Dhps T G 8: 85,074,251 S240A probably benign Het
Dnah5 T A 15: 28,234,453 probably null Het
Dock10 T C 1: 80,536,959 T1414A probably benign Het
Dock4 A G 12: 40,755,813 D928G probably damaging Het
Dolpp1 T C 2: 30,395,646 probably benign Het
Dse T A 10: 34,152,605 I830F probably damaging Het
Elmod1 C T 9: 53,935,807 R29Q probably damaging Het
Ephx4 T A 5: 107,429,652 probably null Het
Evi5 A T 5: 107,820,436 M215K probably damaging Het
Fbxl4 T C 4: 22,390,678 L287P probably damaging Het
Gbp9 G A 5: 105,082,858 S400L probably damaging Het
Gm6291 T C 18: 6,371,365 noncoding transcript Het
Gmcl1 A T 6: 86,711,614 D301E probably benign Het
Gna14 C T 19: 16,603,328 R177C possibly damaging Het
Golph3 C T 15: 12,339,670 R90C probably damaging Het
Gpr142 T A 11: 114,798,959 C12* probably null Het
Hat1 T A 2: 71,409,013 N43K possibly damaging Het
Hivep1 A T 13: 42,157,218 E978V possibly damaging Het
Hormad1 G A 3: 95,559,733 probably null Het
Kalrn C T 16: 33,975,435 probably benign Het
Mars T C 10: 127,296,549 T860A probably benign Het
Mdn1 A T 4: 32,695,400 L1146F probably damaging Het
Met A G 6: 17,531,582 T620A probably benign Het
Mppe1 T C 18: 67,225,763 E378G probably benign Het
Myh14 A T 7: 44,606,709 L1924Q probably damaging Het
Mylip G T 13: 45,408,702 E327* probably null Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Naip6 A G 13: 100,315,992 V187A possibly damaging Het
Ncam1 T A 9: 49,507,043 T986S probably benign Het
Olfr1274-ps T C 2: 90,401,456 I265T probably benign Het
Olfr1342 T C 4: 118,690,117 I112V probably damaging Het
Phactr2 C T 10: 13,245,517 G480S probably damaging Het
Por A G 5: 135,715,984 I34V probably benign Het
Ppp2r5b C T 19: 6,234,734 R33H probably damaging Het
Prkdc C A 16: 15,752,829 Y2325* probably null Het
Prx A G 7: 27,515,284 E73G probably damaging Het
Rbms2 C A 10: 128,145,687 A126S possibly damaging Het
Rhoq C T 17: 86,994,689 A111V probably damaging Het
Rpl14 T A 9: 120,574,174 probably benign Het
Serbp1 A G 6: 67,272,886 *75W probably null Het
Sptbn1 C A 11: 30,123,978 V1351F probably damaging Het
Supt16 A G 14: 52,164,522 V897A probably benign Het
Tfdp1 T A 8: 13,357,038 probably null Het
Ttn T A 2: 76,950,143 Y1088F probably damaging Het
Vmn2r105 G T 17: 20,228,667 Q83K probably benign Het
Wdr76 A T 2: 121,528,842 S221C probably damaging Het
Zfhx2 G T 14: 55,065,891 F1545L probably benign Het
Zfp318 A G 17: 46,399,033 I561V probably damaging Het
Other mutations in Mybpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mybpc3 APN 2 91120029 missense probably benign
IGL00985:Mybpc3 APN 2 91135359 missense probably benign 0.16
IGL01926:Mybpc3 APN 2 91135407 missense possibly damaging 0.61
IGL02135:Mybpc3 APN 2 91124826 missense possibly damaging 0.58
IGL02187:Mybpc3 APN 2 91135452 missense probably benign
IGL02219:Mybpc3 APN 2 91121023 critical splice acceptor site probably null
IGL02752:Mybpc3 APN 2 91132637 critical splice acceptor site probably null
IGL03002:Mybpc3 APN 2 91123889 missense probably damaging 1.00
IGL03118:Mybpc3 APN 2 91124503 missense probably damaging 1.00
IGL03238:Mybpc3 APN 2 91131659 missense probably damaging 1.00
R0010:Mybpc3 UTSW 2 91134833 nonsense probably null
R0114:Mybpc3 UTSW 2 91124494 missense probably damaging 1.00
R0139:Mybpc3 UTSW 2 91120337 splice site probably benign
R0282:Mybpc3 UTSW 2 91124024 splice site probably benign
R0673:Mybpc3 UTSW 2 91120427 missense probably damaging 1.00
R1388:Mybpc3 UTSW 2 91122874 missense probably benign 0.43
R2159:Mybpc3 UTSW 2 91125370 missense probably damaging 1.00
R2424:Mybpc3 UTSW 2 91135793 missense probably benign 0.20
R3983:Mybpc3 UTSW 2 91135369 missense probably benign
R4322:Mybpc3 UTSW 2 91123961 missense possibly damaging 0.87
R4909:Mybpc3 UTSW 2 91134812 missense probably benign
R4913:Mybpc3 UTSW 2 91126264 missense possibly damaging 0.46
R4965:Mybpc3 UTSW 2 91119247 missense possibly damaging 0.50
R5248:Mybpc3 UTSW 2 91125228 intron probably null
R5311:Mybpc3 UTSW 2 91128678 nonsense probably null
R5332:Mybpc3 UTSW 2 91122938 missense probably damaging 1.00
R5635:Mybpc3 UTSW 2 91134829 missense probably benign 0.00
R5647:Mybpc3 UTSW 2 91121722 splice site probably null
R5698:Mybpc3 UTSW 2 91124849 missense possibly damaging 0.85
R5832:Mybpc3 UTSW 2 91119175 splice site probably null
R6833:Mybpc3 UTSW 2 91125428 splice site probably null
R7061:Mybpc3 UTSW 2 91125404 missense possibly damaging 0.93
R7144:Mybpc3 UTSW 2 91134604 missense probably benign 0.03
R7169:Mybpc3 UTSW 2 91118179 missense possibly damaging 0.85
R7472:Mybpc3 UTSW 2 91131656 missense probably damaging 1.00
R7538:Mybpc3 UTSW 2 91120487 missense probably damaging 1.00
R7677:Mybpc3 UTSW 2 91129031 missense probably benign 0.04
Z1088:Mybpc3 UTSW 2 91135359 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTTTGTCAAAGGTGGGCCAG -3'
(R):5'- GCATAGTGTCCTGCATCCTC -3'

Sequencing Primer
(F):5'- CAAAGGTGGGCCAGGGACC -3'
(R):5'- CCAGGGTTGCTTCATTGATGATCAAG -3'
Posted On2017-02-15