Incidental Mutation 'R5895:Kalrn'
ID 457477
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock # R5895 (G1)
Quality Score 163
Status Validated
Chromosome 16
Chromosomal Location 33969073-34573532 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) C to T at 33975435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: 2965
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: 2965

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114973
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,617 T249A probably benign Het
Abcb1a G A 5: 8,702,216 G426S probably damaging Het
Casp4 A T 9: 5,328,573 probably benign Het
Ccdc40 T A 11: 119,253,403 F988Y probably damaging Het
Chd5 T A 4: 152,379,932 V1516E probably benign Het
Chrnd T A 1: 87,195,667 probably null Het
Col5a3 C A 9: 20,772,442 G1506V unknown Het
Csgalnact2 A T 6: 118,129,254 C34* probably null Het
Ddx23 T C 15: 98,651,951 K195E probably benign Het
Dhps T G 8: 85,074,251 S240A probably benign Het
Dnah5 T A 15: 28,234,453 probably null Het
Dock10 T C 1: 80,536,959 T1414A probably benign Het
Dock4 A G 12: 40,755,813 D928G probably damaging Het
Dolpp1 T C 2: 30,395,646 probably benign Het
Dse T A 10: 34,152,605 I830F probably damaging Het
Elmod1 C T 9: 53,935,807 R29Q probably damaging Het
Ephx4 T A 5: 107,429,652 probably null Het
Evi5 A T 5: 107,820,436 M215K probably damaging Het
Fbxl4 T C 4: 22,390,678 L287P probably damaging Het
Gbp9 G A 5: 105,082,858 S400L probably damaging Het
Gm6291 T C 18: 6,371,365 noncoding transcript Het
Gmcl1 A T 6: 86,711,614 D301E probably benign Het
Gna14 C T 19: 16,603,328 R177C possibly damaging Het
Golph3 C T 15: 12,339,670 R90C probably damaging Het
Gpr142 T A 11: 114,798,959 C12* probably null Het
Hat1 T A 2: 71,409,013 N43K possibly damaging Het
Hivep1 A T 13: 42,157,218 E978V possibly damaging Het
Hormad1 G A 3: 95,559,733 probably null Het
Mars T C 10: 127,296,549 T860A probably benign Het
Mdn1 A T 4: 32,695,400 L1146F probably damaging Het
Met A G 6: 17,531,582 T620A probably benign Het
Mppe1 T C 18: 67,225,763 E378G probably benign Het
Mybpc3 T A 2: 91,124,665 V481D probably damaging Het
Myh14 A T 7: 44,606,709 L1924Q probably damaging Het
Mylip G T 13: 45,408,702 E327* probably null Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Naip6 A G 13: 100,315,992 V187A possibly damaging Het
Ncam1 T A 9: 49,507,043 T986S probably benign Het
Olfr1274-ps T C 2: 90,401,456 I265T probably benign Het
Olfr1342 T C 4: 118,690,117 I112V probably damaging Het
Phactr2 C T 10: 13,245,517 G480S probably damaging Het
Por A G 5: 135,715,984 I34V probably benign Het
Ppp2r5b C T 19: 6,234,734 R33H probably damaging Het
Prkdc C A 16: 15,752,829 Y2325* probably null Het
Prx A G 7: 27,515,284 E73G probably damaging Het
Rbms2 C A 10: 128,145,687 A126S possibly damaging Het
Rhoq C T 17: 86,994,689 A111V probably damaging Het
Rpl14 T A 9: 120,574,174 probably benign Het
Serbp1 A G 6: 67,272,886 *75W probably null Het
Sptbn1 C A 11: 30,123,978 V1351F probably damaging Het
Supt16 A G 14: 52,164,522 V897A probably benign Het
Tfdp1 T A 8: 13,357,038 probably null Het
Ttn T A 2: 76,950,143 Y1088F probably damaging Het
Vmn2r105 G T 17: 20,228,667 Q83K probably benign Het
Wdr76 A T 2: 121,528,842 S221C probably damaging Het
Zfhx2 G T 14: 55,065,891 F1545L probably benign Het
Zfp318 A G 17: 46,399,033 I561V probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
ethereal UTSW 16 33975435 utr 3 prime probably benign
Hidden UTSW 16 34027976 missense probably damaging 1.00
Soulful UTSW 16 34187484 nonsense probably null
G1Funyon:Kalrn UTSW 16 34357100 missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 splice site probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34031582 missense probably benign 0.04
R7796:Kalrn UTSW 16 34187484 nonsense probably null
R7867:Kalrn UTSW 16 33989791 missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33988847 missense probably damaging 0.98
R7914:Kalrn UTSW 16 34028752 missense probably benign
R8080:Kalrn UTSW 16 33975668 missense possibly damaging 0.83
R8147:Kalrn UTSW 16 34055044 missense probably benign
R8239:Kalrn UTSW 16 34049783 missense noncoding transcript
R8281:Kalrn UTSW 16 34035061 nonsense probably null
R8294:Kalrn UTSW 16 34033584 missense probably benign 0.12
R8301:Kalrn UTSW 16 34357100 missense probably benign 0.05
R8686:Kalrn UTSW 16 34360935 missense probably damaging 1.00
R8693:Kalrn UTSW 16 34034514 missense probably damaging 1.00
R8798:Kalrn UTSW 16 33982855 missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34198460 missense probably benign 0.05
R8878:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R8880:Kalrn UTSW 16 34217935 missense probably damaging 1.00
R8883:Kalrn UTSW 16 33993655 missense probably damaging 1.00
R8887:Kalrn UTSW 16 34227126 missense probably benign 0.22
R9048:Kalrn UTSW 16 34034484 missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34361001 missense probably damaging 0.96
R9317:Kalrn UTSW 16 34013675 missense
R9424:Kalrn UTSW 16 33988818 missense probably benign 0.06
R9442:Kalrn UTSW 16 34095879 start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33985230 missense probably benign 0.13
RF014:Kalrn UTSW 16 34039933 missense probably benign 0.01
Z1177:Kalrn UTSW 16 34035506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTACGGTTTTCCCACTTAAC -3'
(R):5'- CAAGCACCAGAATGATGTGCG -3'

Sequencing Primer
(F):5'- CCACTTAACTGCTCATTTTGGAATG -3'
(R):5'- AGAATGATGTGCGGCCCATTC -3'
Posted On 2017-02-15