Incidental Mutation 'R5896:Slc7a14'
ID 457496
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 044095-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R5896 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 31257007-31364527 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31311719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 100 (L100F)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: L100F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: L100F

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108245
AA Change: L100F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: L100F

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,504,321 (GRCm39) S159T probably damaging Het
2610028H24Rik T A 10: 76,288,664 (GRCm39) M53K probably benign Het
3425401B19Rik G A 14: 32,383,632 (GRCm39) Q778* probably null Het
Abhd16a T A 17: 35,310,701 (GRCm39) probably benign Het
Acp6 A G 3: 97,075,810 (GRCm39) K226R probably benign Het
Ankfy1 A G 11: 72,650,811 (GRCm39) D998G probably damaging Het
Apbb1 G T 7: 105,223,432 (GRCm39) P60T probably damaging Het
Apol9a T A 15: 77,288,705 (GRCm39) I221F probably benign Het
Arhgap29 A G 3: 121,805,736 (GRCm39) E947G possibly damaging Het
B430218F22Rik A T 13: 118,523,934 (GRCm39) probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,741,456 (GRCm39) probably null Het
Ccdc69 C T 11: 54,943,716 (GRCm39) probably null Het
Ccdc93 G T 1: 121,390,849 (GRCm39) V274L possibly damaging Het
Cdc25a A G 9: 109,713,433 (GRCm39) D191G probably benign Het
Cimip2a A T 2: 25,110,578 (GRCm39) M129L probably benign Het
Cmya5 A G 13: 93,182,373 (GRCm39) probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,092,479 (GRCm39) probably benign Het
Csde1 T C 3: 102,947,859 (GRCm39) probably benign Het
Ctdp1 A G 18: 80,502,003 (GRCm39) L177P probably damaging Het
Dnah5 T A 15: 28,272,206 (GRCm39) H1003Q probably benign Het
Epb41l2 T A 10: 25,369,494 (GRCm39) N604K probably damaging Het
Fig4 T A 10: 41,130,881 (GRCm39) N465Y possibly damaging Het
Gemin7 G A 7: 19,299,223 (GRCm39) S124F probably damaging Het
Gli3 G A 13: 15,900,765 (GRCm39) R1384K probably benign Het
Gm12258 G A 11: 58,750,457 (GRCm39) C544Y probably damaging Het
Grm1 C T 10: 10,956,294 (GRCm39) probably benign Het
H2-T15 T A 17: 36,367,236 (GRCm39) M329L probably benign Het
Hps4 C T 5: 112,517,351 (GRCm39) T246I probably benign Het
Ifngr2 A T 16: 91,358,653 (GRCm39) E284D possibly damaging Het
Impdh2 A G 9: 108,441,165 (GRCm39) T148A probably benign Het
Irx3 T C 8: 92,527,763 (GRCm39) S36G probably benign Het
Itga5 T A 15: 103,259,514 (GRCm39) K667N probably benign Het
Itgad G A 7: 127,773,188 (GRCm39) C15Y probably benign Het
Ly75 T G 2: 60,213,490 (GRCm39) E29A probably benign Het
Magi1 T A 6: 93,685,180 (GRCm39) S506C probably damaging Het
Map4 G A 9: 109,901,702 (GRCm39) V781M possibly damaging Het
Med23 T C 10: 24,778,043 (GRCm39) L797P probably damaging Het
Naip1 C T 13: 100,559,636 (GRCm39) G1123R probably benign Het
Ncor1 G T 11: 62,274,016 (GRCm39) P55Q probably damaging Het
Odr4 A T 1: 150,256,111 (GRCm39) N211K probably benign Het
Ofcc1 T A 13: 40,334,060 (GRCm39) I344F probably benign Het
Or4a74 C A 2: 89,439,667 (GRCm39) V260F probably damaging Het
Or4d5 A T 9: 40,012,189 (GRCm39) M199K probably damaging Het
Or5d35 A G 2: 87,855,465 (GRCm39) Y133C probably damaging Het
Or5k1 G A 16: 58,618,095 (GRCm39) T38I probably damaging Het
Otub2 C T 12: 103,369,687 (GRCm39) probably benign Het
Parva A G 7: 112,143,960 (GRCm39) M83V probably benign Het
Pcdha8 T A 18: 37,126,572 (GRCm39) N351K probably benign Het
Pcdhb5 T A 18: 37,455,732 (GRCm39) L704* probably null Het
Pkd1l3 T A 8: 110,353,468 (GRCm39) L683H probably damaging Het
Plekhn1 C T 4: 156,308,331 (GRCm39) R288H probably benign Het
Polr2a A T 11: 69,627,086 (GRCm39) N1457K probably damaging Het
Ppp1r12b A G 1: 134,693,719 (GRCm39) S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 (GRCm39) K1062E probably damaging Het
Ptpre A T 7: 135,276,007 (GRCm39) T498S probably benign Het
Pus7l C T 15: 94,427,332 (GRCm39) probably null Het
Rptn C T 3: 93,305,639 (GRCm39) Q991* probably null Het
Rsu1 T G 2: 13,229,170 (GRCm39) E76A probably damaging Het
Septin11 T A 5: 93,304,824 (GRCm39) F214I probably damaging Het
Slc1a7 G T 4: 107,869,587 (GRCm39) A551S probably benign Het
Slc45a2 T A 15: 11,000,941 (GRCm39) Y13* probably null Het
Slit3 A G 11: 35,598,932 (GRCm39) E1512G probably damaging Het
Stat5a A G 11: 100,767,883 (GRCm39) Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 (GRCm39) T1811A possibly damaging Het
Tarbp1 A G 8: 127,179,667 (GRCm39) F624L probably benign Het
Tfeb T G 17: 48,070,433 (GRCm39) probably null Het
Tnxb G A 17: 34,891,126 (GRCm39) G490R probably damaging Het
Tra2b T C 16: 22,077,953 (GRCm39) Y32C probably damaging Het
Trpv4 C T 5: 114,760,708 (GRCm39) probably benign Het
Uvrag A T 7: 98,637,414 (GRCm39) L138* probably null Het
Vwf A T 6: 125,655,725 (GRCm39) probably null Het
Wdr47 G A 3: 108,526,322 (GRCm39) D282N probably damaging Het
Xirp2 A G 2: 67,340,290 (GRCm39) N844D possibly damaging Het
Xirp2 A G 2: 67,339,042 (GRCm39) M428V probably benign Het
Znfx1 G A 2: 166,880,920 (GRCm39) T288I probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31,292,827 (GRCm39) missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31,311,912 (GRCm39) missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31,292,919 (GRCm39) missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31,291,558 (GRCm39) missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31,277,664 (GRCm39) missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31,281,209 (GRCm39) missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31,278,267 (GRCm39) missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31,291,598 (GRCm39) missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31,291,511 (GRCm39) splice site probably benign
R2057:Slc7a14 UTSW 3 31,291,645 (GRCm39) missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31,284,469 (GRCm39) missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31,291,650 (GRCm39) missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31,291,623 (GRCm39) missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31,311,831 (GRCm39) missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31,284,547 (GRCm39) missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31,291,615 (GRCm39) missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31,291,514 (GRCm39) splice site probably null
R5345:Slc7a14 UTSW 3 31,278,006 (GRCm39) missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31,311,919 (GRCm39) missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31,278,346 (GRCm39) missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31,278,059 (GRCm39) missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31,292,856 (GRCm39) missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31,263,385 (GRCm39) missense probably benign
R6020:Slc7a14 UTSW 3 31,278,261 (GRCm39) missense probably benign
R6107:Slc7a14 UTSW 3 31,311,759 (GRCm39) missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31,291,697 (GRCm39) missense probably benign
R6491:Slc7a14 UTSW 3 31,278,093 (GRCm39) missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31,278,372 (GRCm39) missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31,277,728 (GRCm39) missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31,281,212 (GRCm39) missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31,278,384 (GRCm39) missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31,281,302 (GRCm39) missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31,311,880 (GRCm39) missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31,263,361 (GRCm39) missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31,281,300 (GRCm39) missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31,278,282 (GRCm39) missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31,311,759 (GRCm39) missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31,277,595 (GRCm39) missense probably damaging 0.98
R9011:Slc7a14 UTSW 3 31,278,345 (GRCm39) missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31,281,359 (GRCm39) missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31,278,166 (GRCm39) missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31,278,148 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAGGACAGAATTGAATTGCAC -3'
(R):5'- ACCAAACCAGTGGAGTCCATG -3'

Sequencing Primer
(F):5'- TGCACAAATTGTCCTCAGGTAC -3'
(R):5'- TCCATGCTGGAGGGAACTG -3'
Posted On 2017-02-15