Incidental Mutation 'R5896:Slc1a7'
ID457504
Institutional Source Beutler Lab
Gene Symbol Slc1a7
Ensembl Gene ENSMUSG00000008932
Gene Namesolute carrier family 1 (glutamate transporter), member 7
SynonymsEAAT5
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5896 (G1)
Quality Score176
Status Validated
Chromosome4
Chromosomal Location107968332-108013532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108012390 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 551 (A551S)
Ref Sequence ENSEMBL: ENSMUSP00000102324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000106713] [ENSMUST00000146851]
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106708
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106709
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106713
AA Change: A551S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102324
Gene: ENSMUSG00000008932
AA Change: A551S

DomainStartEndE-ValueType
Pfam:SDF 29 485 1.9e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145491
Predicted Effect probably benign
Transcript: ENSMUST00000146851
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Slc1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc1a7 APN 4 107992965 missense probably damaging 1.00
IGL02643:Slc1a7 APN 4 108012300 missense possibly damaging 0.86
IGL03146:Slc1a7 APN 4 107992992 missense probably damaging 0.98
R1023:Slc1a7 UTSW 4 108007573 missense probably damaging 1.00
R1629:Slc1a7 UTSW 4 108008143 missense probably damaging 1.00
R1869:Slc1a7 UTSW 4 108008364 missense probably damaging 1.00
R1957:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1970:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1971:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R2058:Slc1a7 UTSW 4 108004439 missense probably benign 0.41
R2201:Slc1a7 UTSW 4 107993006 missense probably damaging 1.00
R2212:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3412:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3413:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3414:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3734:Slc1a7 UTSW 4 107977644 missense probably damaging 1.00
R4109:Slc1a7 UTSW 4 107968661 missense probably benign 0.22
R4662:Slc1a7 UTSW 4 108007554 missense probably damaging 1.00
R4676:Slc1a7 UTSW 4 107977674 missense possibly damaging 0.95
R4801:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4802:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4935:Slc1a7 UTSW 4 108007561 missense probably damaging 1.00
R5947:Slc1a7 UTSW 4 108010300 unclassified probably benign
R6056:Slc1a7 UTSW 4 108012261 missense probably benign 0.00
R6088:Slc1a7 UTSW 4 108012444 missense probably damaging 1.00
R6134:Slc1a7 UTSW 4 108012436 missense probably damaging 1.00
R6141:Slc1a7 UTSW 4 108002182 missense possibly damaging 0.50
R7378:Slc1a7 UTSW 4 108002203 missense possibly damaging 0.50
R7587:Slc1a7 UTSW 4 108010486 missense possibly damaging 0.93
R7974:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R7975:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8002:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8003:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8022:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8023:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8075:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8142:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8145:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8205:Slc1a7 UTSW 4 108008311 missense probably benign 0.12
R8257:Slc1a7 UTSW 4 108008197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGGGAAGAGACATGCTTC -3'
(R):5'- TCAGTGACTGACTAGCCTGTC -3'

Sequencing Primer
(F):5'- GAGCTCACACCCTCACTTTTAAATG -3'
(R):5'- TCAGGGTGGAATGTGCCAG -3'
Posted On2017-02-15