Incidental Mutation 'R5896:Trpv4'
ID457508
Institutional Source Beutler Lab
Gene Symbol Trpv4
Ensembl Gene ENSMUSG00000014158
Gene Nametransient receptor potential cation channel, subfamily V, member 4
SynonymsVROAC, 0610033B08Rik, Trp12, VR-OAC, VRL-2, OTRPC4
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5896 (G1)
Quality Score199
Status Validated
Chromosome5
Chromosomal Location114622152-114658421 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 114622647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071968] [ENSMUST00000112217] [ENSMUST00000112219] [ENSMUST00000112222] [ENSMUST00000112225]
Predicted Effect probably benign
Transcript: ENSMUST00000071968
SMART Domains Protein: ENSMUSP00000071859
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 468 730 9.9e-13 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112217
SMART Domains Protein: ENSMUSP00000107836
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 1e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 2e-12 BLAST
ANK 369 397 1.02e3 SMART
transmembrane domain 409 431 N/A INTRINSIC
Pfam:Ion_trans 455 658 3.3e-8 PFAM
Blast:PHB 693 744 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112219
SMART Domains Protein: ENSMUSP00000107838
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 350 1.02e3 SMART
transmembrane domain 362 384 N/A INTRINSIC
Pfam:Ion_trans 408 611 3e-8 PFAM
Blast:PHB 646 697 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112222
SMART Domains Protein: ENSMUSP00000107840
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 351 3.49e0 SMART
low complexity region 368 378 N/A INTRINSIC
Blast:ANK 395 420 1e-6 BLAST
Pfam:Ion_trans 468 671 3.4e-8 PFAM
Blast:PHB 706 757 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112225
SMART Domains Protein: ENSMUSP00000107844
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 515 718 3.4e-8 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141828
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a null allele show abnormal touch/ nociception and late-onset hearing loss. Homozygotes for a different null allele show impaired bladder voiding, abnormalities in touch/ nociception, osmotic regulation and vasodilation, ocular hypertension but no hearing or vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Trpv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trpv4 APN 5 114628625 missense probably damaging 1.00
IGL01804:Trpv4 APN 5 114644786 missense possibly damaging 0.77
IGL01955:Trpv4 APN 5 114622682 nonsense probably null
IGL02115:Trpv4 APN 5 114625029 missense probably damaging 1.00
IGL02375:Trpv4 APN 5 114636357 missense probably benign 0.10
IGL02870:Trpv4 APN 5 114625056 missense probably damaging 1.00
PIT4472001:Trpv4 UTSW 5 114626923 missense probably damaging 0.99
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0217:Trpv4 UTSW 5 114634661 missense possibly damaging 0.68
R0346:Trpv4 UTSW 5 114630529 splice site probably benign
R0358:Trpv4 UTSW 5 114630432 missense probably damaging 1.00
R1745:Trpv4 UTSW 5 114633154 missense probably damaging 1.00
R1880:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R1881:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R2018:Trpv4 UTSW 5 114634605 missense probably damaging 1.00
R2093:Trpv4 UTSW 5 114635504 missense probably damaging 1.00
R2172:Trpv4 UTSW 5 114644710 missense probably damaging 1.00
R2679:Trpv4 UTSW 5 114635552 missense probably damaging 1.00
R3699:Trpv4 UTSW 5 114634800 missense probably damaging 1.00
R4731:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4732:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4733:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4822:Trpv4 UTSW 5 114630022 missense possibly damaging 0.66
R4985:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R4987:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R5026:Trpv4 UTSW 5 114622654 makesense probably null
R5105:Trpv4 UTSW 5 114626920 missense probably damaging 1.00
R5236:Trpv4 UTSW 5 114622795 missense possibly damaging 0.81
R5330:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5331:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5396:Trpv4 UTSW 5 114623614 missense possibly damaging 0.77
R5423:Trpv4 UTSW 5 114636445 missense probably benign 0.25
R5667:Trpv4 UTSW 5 114634556 missense probably damaging 1.00
R6239:Trpv4 UTSW 5 114644826 missense probably benign
R6762:Trpv4 UTSW 5 114625110 missense probably benign 0.07
R6952:Trpv4 UTSW 5 114633202 missense probably damaging 1.00
R7191:Trpv4 UTSW 5 114633140 missense probably benign
R7343:Trpv4 UTSW 5 114636459 missense probably benign 0.42
R7951:Trpv4 UTSW 5 114622810 missense probably benign 0.33
R8551:Trpv4 UTSW 5 114630839 missense possibly damaging 0.96
R8803:Trpv4 UTSW 5 114634755 missense probably benign 0.08
R8871:Trpv4 UTSW 5 114630450 missense probably benign 0.00
Z1177:Trpv4 UTSW 5 114634612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGGCAAAAGTCTTGG -3'
(R):5'- AGTACTCAGTGGTGCTCAATGC -3'

Sequencing Primer
(F):5'- CAAAAGTCTTGGCGGGGAC -3'
(R):5'- AATGCTTGCACGGCCTATTAAC -3'
Posted On2017-02-15