Incidental Mutation 'R5896:Tarbp1'
ID457522
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126452928 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 624 (F624L)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably benign
Transcript: ENSMUST00000170518
AA Change: F624L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: F624L

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 126444301 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 126444195 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAAGTGATTGCAGAGCCCAC -3'
(R):5'- CAGTTTATCATAGAGCTCAGTGGG -3'

Sequencing Primer
(F):5'- GAGCCCACTCGTCCTCAC -3'
(R):5'- TTGTGTCCCAACCCTGTGAGG -3'
Posted On2017-02-15