Incidental Mutation 'R5896:Ankfy1'
ID457540
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Nameankyrin repeat and FYVE domain containing 1
SynonymsAnkhzn
MMRRC Submission 044095-MU
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72690006-72772146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72759985 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 998 (D998G)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102548
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147195
Predicted Effect probably damaging
Transcript: ENSMUST00000155998
AA Change: D998G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: D998G

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Meta Mutation Damage Score 0.8922 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGTGAAGGGATAGCTCTGTG -3'
(R):5'- TGGCCTCTGATGAAATGAGTTG -3'

Sequencing Primer
(F):5'- GCTTGGCTGGTCAGTTCTC -3'
(R):5'- CCTCTGATGAAATGAGTTGCAAAG -3'
Posted On2017-02-15