Incidental Mutation 'R5896:Cmya5'
ID 457544
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R5896 (G1)
Quality Score 183
Status Validated
Chromosome 13
Chromosomal Location 93040713-93144724 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 93045865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062122
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93094262 missense probably benign 0.00
R7825:Cmya5 UTSW 13 93097628 missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93089757 missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93096357 missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93097004 small deletion probably benign
R8127:Cmya5 UTSW 13 93094614 missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93093478 missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93091634 nonsense probably null
R8446:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93093796 missense probably benign 0.00
R8686:Cmya5 UTSW 13 93095380 missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93089721 missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93089380 missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93041483 missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93063540 missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93096332 missense probably benign 0.01
R8985:Cmya5 UTSW 13 93097156 missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93092064 missense probably benign 0.03
R9087:Cmya5 UTSW 13 93097203 missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93097600 missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93097370 missense unknown
R9209:Cmya5 UTSW 13 93090358 missense probably benign 0.45
R9222:Cmya5 UTSW 13 93094071 missense probably benign 0.00
R9229:Cmya5 UTSW 13 93095668 missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93093376 missense probably benign
R9385:Cmya5 UTSW 13 93094372 missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93089701 missense probably benign 0.22
R9452:Cmya5 UTSW 13 93095886 missense probably benign
R9492:Cmya5 UTSW 13 93041314 makesense probably null
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93096790 missense unknown
Z1177:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGAGGTTGAATATACGGCATCC -3'
(R):5'- TCAACTCTGCTTGCAGGATCC -3'

Sequencing Primer
(F):5'- GGTTGAATATACGGCATCCTCTTATC -3'
(R):5'- TTGCAGGATCCCCTCAGTG -3'
Posted On 2017-02-15