Incidental Mutation 'R5896:Carmil3'
ID457548
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Namecapping protein regulator and myosin 1 linker 3
SynonymsLrrc16b
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R5896 (G1)
Quality Score106
Status Not validated
Chromosome14
Chromosomal Location55490651-55508272 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACCCCC to ACCCCCCC at 55503999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect probably null
Transcript: ENSMUST00000076236
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226653
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55498298 missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55501895 critical splice donor site probably null
IGL01061:Carmil3 APN 14 55498630 missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55496058 missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55493849 missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55494227 missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55493536 missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55493822 splice site probably benign
IGL02160:Carmil3 APN 14 55493558 missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55504517 missense probably benign 0.00
IGL02567:Carmil3 APN 14 55498882 missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55499068 missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55507410 missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55494718 missense probably damaging 0.99
PIT4434001:Carmil3 UTSW 14 55494688 missense probably null 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55494403 missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55497755 splice site probably benign
R0321:Carmil3 UTSW 14 55502241 missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55495442 missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55499861 missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55502435 critical splice donor site probably null
R1503:Carmil3 UTSW 14 55498280 missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55496282 missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55504532 missense probably benign 0.02
R1923:Carmil3 UTSW 14 55502404 missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55498630 missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55503838 missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55498313 missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55507694 missense probably benign 0.05
R3552:Carmil3 UTSW 14 55507402 missense possibly damaging 0.86
R3783:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R3787:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55503955 missense probably benign 0.10
R4285:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55493588 missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55501471 missense probably benign
R4506:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55505664 splice site probably null
R4574:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R4784:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R5146:Carmil3 UTSW 14 55497179 missense probably benign 0.02
R5279:Carmil3 UTSW 14 55501571 missense probably damaging 0.98
R5425:Carmil3 UTSW 14 55493877 missense probably benign 0.41
R5530:Carmil3 UTSW 14 55493624 missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55494890 missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55503999 frame shift probably null
R5772:Carmil3 UTSW 14 55493239 missense probably damaging 1.00
R5931:Carmil3 UTSW 14 55498940 missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55503845 missense probably benign 0.00
R6103:Carmil3 UTSW 14 55505427 missense probably benign 0.02
R6258:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55507930 missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55501561 missense probably benign 0.04
R7164:Carmil3 UTSW 14 55501282 missense probably damaging 0.98
R7214:Carmil3 UTSW 14 55498612 missense probably damaging 1.00
R7223:Carmil3 UTSW 14 55496238 missense possibly damaging 0.48
R7269:Carmil3 UTSW 14 55493895 missense probably benign 0.03
R7319:Carmil3 UTSW 14 55494360 missense probably benign 0.13
R7357:Carmil3 UTSW 14 55491133 start gained probably benign
R7386:Carmil3 UTSW 14 55497747 critical splice donor site probably null
R7463:Carmil3 UTSW 14 55502396 missense probably damaging 1.00
R7598:Carmil3 UTSW 14 55494821 missense possibly damaging 0.61
R7602:Carmil3 UTSW 14 55501508 missense probably null 0.00
R7617:Carmil3 UTSW 14 55497891 missense probably benign 0.06
R7985:Carmil3 UTSW 14 55496952 missense probably benign 0.03
R8127:Carmil3 UTSW 14 55498244 missense probably damaging 0.98
R8423:Carmil3 UTSW 14 55499065 missense probably damaging 1.00
R8465:Carmil3 UTSW 14 55496848 missense probably damaging 1.00
R8849:Carmil3 UTSW 14 55497170 missense probably benign 0.01
R8955:Carmil3 UTSW 14 55496077 missense probably damaging 0.98
U24488:Carmil3 UTSW 14 55497179 missense probably benign 0.02
Z1088:Carmil3 UTSW 14 55501568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGCTGCCTGAGAACCAAG -3'
(R):5'- GTGTAGCACTTCTGGCTCAC -3'

Sequencing Primer
(F):5'- CTTGTCATACTGCATGTGGC -3'
(R):5'- GTAGCACTTCTGGCTCACTTACC -3'
Posted On2017-02-15