Incidental Mutation 'R0558:Pbrm1'
ID45755
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission 038750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationunclassified (2461 bp from exon)
DNA Base Change (assembly) T to A at 31085059 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000064032] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000135704] [ENSMUST00000136237] [ENSMUST00000146325] [ENSMUST00000156628] [ENSMUST00000203261]
Predicted Effect probably benign
Transcript: ENSMUST00000022471
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022474
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064032
SMART Domains Protein: ENSMUSP00000067418
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090214
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112092
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123678
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135704
SMART Domains Protein: ENSMUSP00000115505
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 1 97 3.24e-25 SMART
BROMO 119 233 5.84e-41 SMART
low complexity region 298 314 N/A INTRINSIC
BROMO 323 433 1.57e-32 SMART
BROMO 475 586 6.07e-39 SMART
BROMO 610 724 3.01e-43 SMART
BROMO 734 840 2.53e-18 SMART
low complexity region 862 892 N/A INTRINSIC
BAH 914 1032 1.33e-45 SMART
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136237
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146325
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156407
Predicted Effect probably benign
Transcript: ENSMUST00000156628
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203261
SMART Domains Protein: ENSMUSP00000145018
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4280:Pbrm1 UTSW 14 31107312 critical splice donor site probably null
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4816:Pbrm1 UTSW 14 31110448 missense probably benign 0.32
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 31032519 missense probably benign 0.00
R5522:Pbrm1 UTSW 14 31089563 missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 31045422 missense possibly damaging 0.93
R7588:Pbrm1 UTSW 14 31084943 missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 31030891 missense probably damaging 1.00
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAGATTTGTCCCTCGGGATGTGCC -3'
(R):5'- AGTTCGCCTACTCACTACTCACTGG -3'

Sequencing Primer
(F):5'- CCTTTGCCTGTGGTCCGAG -3'
(R):5'- tgtgtgcctgatgcctg -3'
Posted On2013-06-11