Incidental Mutation 'R5896:Ctdp1'
ID457565
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms4930563P03Rik
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80407959-80469695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80458788 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 177 (L177P)
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229]
Predicted Effect probably damaging
Transcript: ENSMUST00000036229
AA Change: L177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: L177P

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80458692 splice site probably null
IGL01695:Ctdp1 APN 18 80449626 missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80455984 missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80455972 missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80420584 missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80450090 missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80450185 missense probably benign
IGL03117:Ctdp1 APN 18 80449501 missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80449634 nonsense probably null
IGL03385:Ctdp1 APN 18 80449918 missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80449354 missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80447422 critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80450242 missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80469521 missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80449487 missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80450213 missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80449401 missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80449481 missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80450213 nonsense probably null
R3724:Ctdp1 UTSW 18 80459267 missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80452351 missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80449957 missense probably benign
R4298:Ctdp1 UTSW 18 80449957 missense probably benign
R4640:Ctdp1 UTSW 18 80451154 critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80408726 missense unknown
R4842:Ctdp1 UTSW 18 80408726 missense unknown
R5007:Ctdp1 UTSW 18 80420480 missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80456088 missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80447460 missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80408686 missense unknown
R6242:Ctdp1 UTSW 18 80459212 missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80459297 critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80459240 missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80451255 missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80420474 missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80451263 missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80449551 missense probably benign
R6802:Ctdp1 UTSW 18 80420441 critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80440714 splice site probably null
R8121:Ctdp1 UTSW 18 80456008 missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80450110 missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80469279 missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80449463 missense possibly damaging 0.49
X0020:Ctdp1 UTSW 18 80449990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGTGAAGTCTGCCCACAGC -3'
(R):5'- TGCTGTGACAGGCTCCTAAC -3'

Sequencing Primer
(F):5'- TCCCACATATAGGGTTCCCAGG -3'
(R):5'- TCCTAACAGGAAGCAGTGCTATG -3'
Posted On2017-02-15