Incidental Mutation 'R5896:Ctdp1'
ID 457565
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene Name CTD phosphatase subunit 1
Synonyms 4930563P03Rik
MMRRC Submission 044095-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R5896 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 80451174-80512910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80502003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 177 (L177P)
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229]
AlphaFold Q7TSG2
Predicted Effect probably damaging
Transcript: ENSMUST00000036229
AA Change: L177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: L177P

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Meta Mutation Damage Score 0.9248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,504,321 (GRCm39) S159T probably damaging Het
2610028H24Rik T A 10: 76,288,664 (GRCm39) M53K probably benign Het
3425401B19Rik G A 14: 32,383,632 (GRCm39) Q778* probably null Het
Abhd16a T A 17: 35,310,701 (GRCm39) probably benign Het
Acp6 A G 3: 97,075,810 (GRCm39) K226R probably benign Het
Ankfy1 A G 11: 72,650,811 (GRCm39) D998G probably damaging Het
Apbb1 G T 7: 105,223,432 (GRCm39) P60T probably damaging Het
Apol9a T A 15: 77,288,705 (GRCm39) I221F probably benign Het
Arhgap29 A G 3: 121,805,736 (GRCm39) E947G possibly damaging Het
B430218F22Rik A T 13: 118,523,934 (GRCm39) probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,741,456 (GRCm39) probably null Het
Ccdc69 C T 11: 54,943,716 (GRCm39) probably null Het
Ccdc93 G T 1: 121,390,849 (GRCm39) V274L possibly damaging Het
Cdc25a A G 9: 109,713,433 (GRCm39) D191G probably benign Het
Cimip2a A T 2: 25,110,578 (GRCm39) M129L probably benign Het
Cmya5 A G 13: 93,182,373 (GRCm39) probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,092,479 (GRCm39) probably benign Het
Csde1 T C 3: 102,947,859 (GRCm39) probably benign Het
Dnah5 T A 15: 28,272,206 (GRCm39) H1003Q probably benign Het
Epb41l2 T A 10: 25,369,494 (GRCm39) N604K probably damaging Het
Fig4 T A 10: 41,130,881 (GRCm39) N465Y possibly damaging Het
Gemin7 G A 7: 19,299,223 (GRCm39) S124F probably damaging Het
Gli3 G A 13: 15,900,765 (GRCm39) R1384K probably benign Het
Gm12258 G A 11: 58,750,457 (GRCm39) C544Y probably damaging Het
Grm1 C T 10: 10,956,294 (GRCm39) probably benign Het
H2-T15 T A 17: 36,367,236 (GRCm39) M329L probably benign Het
Hps4 C T 5: 112,517,351 (GRCm39) T246I probably benign Het
Ifngr2 A T 16: 91,358,653 (GRCm39) E284D possibly damaging Het
Impdh2 A G 9: 108,441,165 (GRCm39) T148A probably benign Het
Irx3 T C 8: 92,527,763 (GRCm39) S36G probably benign Het
Itga5 T A 15: 103,259,514 (GRCm39) K667N probably benign Het
Itgad G A 7: 127,773,188 (GRCm39) C15Y probably benign Het
Ly75 T G 2: 60,213,490 (GRCm39) E29A probably benign Het
Magi1 T A 6: 93,685,180 (GRCm39) S506C probably damaging Het
Map4 G A 9: 109,901,702 (GRCm39) V781M possibly damaging Het
Med23 T C 10: 24,778,043 (GRCm39) L797P probably damaging Het
Naip1 C T 13: 100,559,636 (GRCm39) G1123R probably benign Het
Ncor1 G T 11: 62,274,016 (GRCm39) P55Q probably damaging Het
Odr4 A T 1: 150,256,111 (GRCm39) N211K probably benign Het
Ofcc1 T A 13: 40,334,060 (GRCm39) I344F probably benign Het
Or4a74 C A 2: 89,439,667 (GRCm39) V260F probably damaging Het
Or4d5 A T 9: 40,012,189 (GRCm39) M199K probably damaging Het
Or5d35 A G 2: 87,855,465 (GRCm39) Y133C probably damaging Het
Or5k1 G A 16: 58,618,095 (GRCm39) T38I probably damaging Het
Otub2 C T 12: 103,369,687 (GRCm39) probably benign Het
Parva A G 7: 112,143,960 (GRCm39) M83V probably benign Het
Pcdha8 T A 18: 37,126,572 (GRCm39) N351K probably benign Het
Pcdhb5 T A 18: 37,455,732 (GRCm39) L704* probably null Het
Pkd1l3 T A 8: 110,353,468 (GRCm39) L683H probably damaging Het
Plekhn1 C T 4: 156,308,331 (GRCm39) R288H probably benign Het
Polr2a A T 11: 69,627,086 (GRCm39) N1457K probably damaging Het
Ppp1r12b A G 1: 134,693,719 (GRCm39) S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 (GRCm39) K1062E probably damaging Het
Ptpre A T 7: 135,276,007 (GRCm39) T498S probably benign Het
Pus7l C T 15: 94,427,332 (GRCm39) probably null Het
Rptn C T 3: 93,305,639 (GRCm39) Q991* probably null Het
Rsu1 T G 2: 13,229,170 (GRCm39) E76A probably damaging Het
Septin11 T A 5: 93,304,824 (GRCm39) F214I probably damaging Het
Slc1a7 G T 4: 107,869,587 (GRCm39) A551S probably benign Het
Slc45a2 T A 15: 11,000,941 (GRCm39) Y13* probably null Het
Slc7a14 T G 3: 31,311,719 (GRCm39) L100F probably damaging Het
Slit3 A G 11: 35,598,932 (GRCm39) E1512G probably damaging Het
Stat5a A G 11: 100,767,883 (GRCm39) Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 (GRCm39) T1811A possibly damaging Het
Tarbp1 A G 8: 127,179,667 (GRCm39) F624L probably benign Het
Tfeb T G 17: 48,070,433 (GRCm39) probably null Het
Tnxb G A 17: 34,891,126 (GRCm39) G490R probably damaging Het
Tra2b T C 16: 22,077,953 (GRCm39) Y32C probably damaging Het
Trpv4 C T 5: 114,760,708 (GRCm39) probably benign Het
Uvrag A T 7: 98,637,414 (GRCm39) L138* probably null Het
Vwf A T 6: 125,655,725 (GRCm39) probably null Het
Wdr47 G A 3: 108,526,322 (GRCm39) D282N probably damaging Het
Xirp2 A G 2: 67,340,290 (GRCm39) N844D possibly damaging Het
Xirp2 A G 2: 67,339,042 (GRCm39) M428V probably benign Het
Znfx1 G A 2: 166,880,920 (GRCm39) T288I probably damaging Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80,501,907 (GRCm39) splice site probably null
IGL01695:Ctdp1 APN 18 80,492,841 (GRCm39) missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80,499,199 (GRCm39) missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80,499,187 (GRCm39) missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80,463,799 (GRCm39) missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80,493,305 (GRCm39) missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80,493,400 (GRCm39) missense probably benign
IGL03117:Ctdp1 APN 18 80,492,716 (GRCm39) missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80,492,849 (GRCm39) nonsense probably null
IGL03385:Ctdp1 APN 18 80,493,133 (GRCm39) missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80,492,569 (GRCm39) missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80,490,637 (GRCm39) critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80,493,457 (GRCm39) missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80,512,736 (GRCm39) missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80,492,702 (GRCm39) missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80,493,428 (GRCm39) missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80,492,616 (GRCm39) missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80,492,696 (GRCm39) missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80,493,428 (GRCm39) nonsense probably null
R3724:Ctdp1 UTSW 18 80,502,482 (GRCm39) missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80,495,566 (GRCm39) missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80,493,172 (GRCm39) missense probably benign
R4298:Ctdp1 UTSW 18 80,493,172 (GRCm39) missense probably benign
R4640:Ctdp1 UTSW 18 80,494,369 (GRCm39) critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R4842:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R5007:Ctdp1 UTSW 18 80,463,695 (GRCm39) missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80,499,303 (GRCm39) missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80,490,675 (GRCm39) missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80,451,901 (GRCm39) missense unknown
R6242:Ctdp1 UTSW 18 80,502,427 (GRCm39) missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80,502,512 (GRCm39) critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80,502,455 (GRCm39) missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80,494,470 (GRCm39) missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80,463,689 (GRCm39) missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80,494,478 (GRCm39) missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80,492,766 (GRCm39) missense probably benign
R6802:Ctdp1 UTSW 18 80,463,656 (GRCm39) critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80,483,929 (GRCm39) splice site probably null
R8121:Ctdp1 UTSW 18 80,499,223 (GRCm39) missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80,493,325 (GRCm39) missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80,512,494 (GRCm39) missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80,492,678 (GRCm39) missense possibly damaging 0.49
R9140:Ctdp1 UTSW 18 80,484,043 (GRCm39) critical splice donor site probably null
R9339:Ctdp1 UTSW 18 80,492,689 (GRCm39) missense probably damaging 1.00
R9617:Ctdp1 UTSW 18 80,492,962 (GRCm39) missense probably benign
R9758:Ctdp1 UTSW 18 80,492,710 (GRCm39) missense probably damaging 1.00
R9762:Ctdp1 UTSW 18 80,492,550 (GRCm39) nonsense probably null
X0020:Ctdp1 UTSW 18 80,493,205 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGTGAAGTCTGCCCACAGC -3'
(R):5'- TGCTGTGACAGGCTCCTAAC -3'

Sequencing Primer
(F):5'- TCCCACATATAGGGTTCCCAGG -3'
(R):5'- TCCTAACAGGAAGCAGTGCTATG -3'
Posted On 2017-02-15