Incidental Mutation 'R5897:Cyp20a1'
ID457567
Institutional Source Beutler Lab
Gene Symbol Cyp20a1
Ensembl Gene ENSMUSG00000049439
Gene Namecytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location60343323-60388060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60353061 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 92 (N92T)
Ref Sequence ENSEMBL: ENSMUSP00000050823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060608] [ENSMUST00000148443]
Predicted Effect probably damaging
Transcript: ENSMUST00000060608
AA Change: N92T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050823
Gene: ENSMUSG00000049439
AA Change: N92T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 40 456 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114202
SMART Domains Protein: ENSMUSP00000109840
Gene: ENSMUSG00000049439

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 40 280 1.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191764
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Cyp20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Cyp20a1 APN 1 60371251 missense possibly damaging 0.79
IGL02725:Cyp20a1 APN 1 60366706 missense probably benign 0.08
IGL03394:Cyp20a1 APN 1 60366681 missense probably damaging 0.99
R0003:Cyp20a1 UTSW 1 60387126 splice site probably benign
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0217:Cyp20a1 UTSW 1 60343466 splice site probably benign
R0491:Cyp20a1 UTSW 1 60371327 missense possibly damaging 0.71
R1543:Cyp20a1 UTSW 1 60376194 splice site probably benign
R4519:Cyp20a1 UTSW 1 60387147 missense probably damaging 1.00
R4621:Cyp20a1 UTSW 1 60376099 missense probably benign
R4930:Cyp20a1 UTSW 1 60366719 missense probably damaging 0.98
R4980:Cyp20a1 UTSW 1 60363214 missense probably damaging 1.00
R5088:Cyp20a1 UTSW 1 60363350 missense probably damaging 0.99
R5356:Cyp20a1 UTSW 1 60379387 missense probably benign 0.08
R5545:Cyp20a1 UTSW 1 60376082 missense possibly damaging 0.71
R5926:Cyp20a1 UTSW 1 60363242 missense possibly damaging 0.52
R6317:Cyp20a1 UTSW 1 60352124 missense probably damaging 1.00
R6320:Cyp20a1 UTSW 1 60352172 critical splice donor site probably null
R7471:Cyp20a1 UTSW 1 60354640 missense probably damaging 0.99
R7681:Cyp20a1 UTSW 1 60353033 missense probably benign 0.01
R7715:Cyp20a1 UTSW 1 60372605 missense probably benign 0.00
R8033:Cyp20a1 UTSW 1 60372591 missense not run
Z1177:Cyp20a1 UTSW 1 60353010 missense not run
Predicted Primers PCR Primer
(F):5'- TTGACTATATCACATGTCTGGGG -3'
(R):5'- TGTTCCCTCAAAAGAACCCTGG -3'

Sequencing Primer
(F):5'- CAGTGGAAGTTTGCATGAG -3'
(R):5'- CCCTGGTGTAATTTACAATCGGAG -3'
Posted On2017-02-15