Mutagenetix > Incidental Mutations

Incidental Mutation 'R5897:Atg16l1'

457568

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

044096-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5897 (G1)

Quality Score

224

Status

Not validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 87785997 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000113190]

Predicted Effect

probably null
Transcript: ENSMUST00000027512

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000027512

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113186

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113186

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113190

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113190

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158656

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,485,964		probably benign	Het
5430419D17Rik	A	T	7: 131,196,551		probably null	Het
Abi3bp	A	G	16: 56,604,669	T489A	possibly damaging	Het
Adam3	T	C	8: 24,697,228	T416A	probably benign	Het
Agbl3	A	G	6: 34,803,573	I494V	probably benign	Het
Akap9	T	C	5: 4,077,904	S3747P	probably benign	Het
Arhgef18	G	T	8: 3,439,682	R338L	probably damaging	Het
BC024139	A	G	15: 76,126,139	S56P	possibly damaging	Het
Ccdc175	T	A	12: 72,159,804	I223L	probably benign	Het
Cep76	T	A	18: 67,638,328	Q78L	probably benign	Het
Cyp20a1	A	C	1: 60,353,061	N92T	probably damaging	Het
Cyp2c68	T	C	19: 39,712,531	D281G	probably benign	Het
Cyp2j12	T	C	4: 96,102,042	N429S	probably damaging	Het
Dchs2	G	A	3: 83,285,410	V1721I	possibly damaging	Het
Elovl4	G	A	9: 83,790,104	T54M	possibly damaging	Het
Fam13b	A	G	18: 34,454,081	V542A	possibly damaging	Het
Gje1	A	T	10: 14,716,723	I105N	probably damaging	Het
Grm4	G	T	17: 27,435,163	F349L	probably benign	Het
Hsd17b3	A	G	13: 64,088,985		probably null	Het
Khdrbs1	A	T	4: 129,720,655	D368E	probably benign	Het
Klra10	T	A	6: 130,281,829	R32*	probably null	Het
Lrrc7	T	A	3: 158,164,353	I644F	probably damaging	Het
Olfr31	G	T	14: 14,328,120	G3V	probably benign	Het
Olfr94	A	T	17: 37,197,260	L161Q	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pbx3	A	T	2: 34,371,908	S5T	probably benign	Het
Pcdhb13	T	A	18: 37,443,211	V214E	probably benign	Het
Pkd1l1	T	C	11: 8,879,176	D1022G	probably benign	Het
Pla2g4a	T	A	1: 149,865,148	K380I	probably damaging	Het
Prl3b1	A	G	13: 27,245,875	T99A	probably benign	Het
Prr12	C	T	7: 45,043,384	V1575I	probably damaging	Het
Ptpn5	C	T	7: 47,079,514	V451I	probably benign	Het
Rab1a	C	T	11: 20,218,867	R51*	probably null	Het
Skint9	A	G	4: 112,413,916	I99T	possibly damaging	Het
Tbc1d8	A	G	1: 39,392,109	V394A	possibly damaging	Het
Tcf20	A	T	15: 82,851,783	C1822*	probably null	Het
Tdrd6	T	A	17: 43,624,877	D1760V	probably damaging	Het
Tinag	C	A	9: 77,045,444	C86F	probably damaging	Het
Tmtc2	A	T	10: 105,413,598	N91K	probably damaging	Het
Tmub1	G	A	5: 24,446,927	T13M	probably benign	Het
Txn2	G	A	15: 77,924,526	A135V	probably benign	Het
Ush2a	G	A	1: 188,821,738	G3475R	probably damaging	Het
Usp38	T	C	8: 81,005,453	D276G	probably benign	Het
Vax1	T	A	19: 59,169,801	I77F	unknown	Het
Vmn2r108	C	T	17: 20,471,318	M314I	probably benign	Het
Vmn2r4	C	A	3: 64,415,266	G11*	probably null	Het
Zcchc14	T	C	8: 121,605,160		probably benign	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0650:Atg16l1	UTSW	1	87781699	missense	possibly damaging	0.93
R0655:Atg16l1	UTSW	1	87766829	missense	probably damaging	1.00
R1421:Atg16l1	UTSW	1	87786358	splice site	probably benign
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R4990:Atg16l1	UTSW	1	87789369	missense	probably benign	0.00
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	splice site	probably null
R7423:Atg16l1	UTSW	1	87786301	missense	probably damaging	1.00
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89
R8493:Atg16l1	UTSW	1	87778982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTTCAGGGCCTGCTGAG -3'
(R):5'- TATAGCTACTACACTCTTGACCACC -3'

Sequencing Primer
(F):5'- CTCCTCTAGGAAGGCAGTATGTAATC -3'
(R):5'- TTGACCACCAAGCCCCC -3'

Posted On

2017-02-15