Incidental Mutation 'R5897:Khdrbs1'
ID457579
Institutional Source Beutler Lab
Gene Symbol Khdrbs1
Ensembl Gene ENSMUSG00000028790
Gene NameKH domain containing, RNA binding, signal transduction associated 1
SynonymsSam68, p62
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129703164-129742303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129720655 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 368 (D368E)
Ref Sequence ENSEMBL: ENSMUSP00000115402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066257] [ENSMUST00000129342]
Predicted Effect probably benign
Transcript: ENSMUST00000066257
AA Change: D368E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066516
Gene: ENSMUSG00000028790
AA Change: D368E

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
KH 154 252 6.91e-11 SMART
low complexity region 281 316 N/A INTRINSIC
low complexity region 326 351 N/A INTRINSIC
Pfam:Sam68-YY 366 415 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129342
AA Change: D368E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115402
Gene: ENSMUSG00000028790
AA Change: D368E

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
KH 154 252 6.91e-11 SMART
low complexity region 281 316 N/A INTRINSIC
low complexity region 326 351 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 377 397 N/A INTRINSIC
PDB:3QHE|D 398 419 3e-8 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the K homology domain-containing, RNA-binding, signal transduction-associated protein family. The encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene protects mice from age-related bone loss and the formation of fatty bone marrow. Males are infertile and females do not care for young. Some die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Khdrbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Khdrbs1 APN 4 129725669 missense probably benign 0.00
IGL01801:Khdrbs1 APN 4 129741781 missense probably benign
IGL03163:Khdrbs1 APN 4 129725715 missense probably benign 0.40
R1163:Khdrbs1 UTSW 4 129725586 missense possibly damaging 0.48
R1350:Khdrbs1 UTSW 4 129720752 missense probably benign
R2059:Khdrbs1 UTSW 4 129725721 missense probably damaging 1.00
R2192:Khdrbs1 UTSW 4 129720037 critical splice donor site probably null
R2518:Khdrbs1 UTSW 4 129720747 missense probably benign
R3000:Khdrbs1 UTSW 4 129725663 missense probably damaging 1.00
R3552:Khdrbs1 UTSW 4 129720791 missense possibly damaging 0.86
R4402:Khdrbs1 UTSW 4 129742096 missense possibly damaging 0.93
R4623:Khdrbs1 UTSW 4 129720842 missense probably benign 0.07
R5138:Khdrbs1 UTSW 4 129741854 missense probably benign 0.13
R5384:Khdrbs1 UTSW 4 129741936 missense possibly damaging 0.70
R5863:Khdrbs1 UTSW 4 129722700 missense probably damaging 0.99
R6018:Khdrbs1 UTSW 4 129720094 missense probably benign
R6153:Khdrbs1 UTSW 4 129716172 missense probably damaging 0.99
R6185:Khdrbs1 UTSW 4 129742275 start gained probably benign
R6377:Khdrbs1 UTSW 4 129742097 missense probably damaging 0.98
R6983:Khdrbs1 UTSW 4 129720842 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTGTATGTTGAACCCACAACTTC -3'
(R):5'- ACCTAGAGGAGCTTTGGTTCG -3'

Sequencing Primer
(F):5'- AGACAAGGCTTCTCTGTATAGCC -3'
(R):5'- TTCGTGGAACCCCAGTGAGAG -3'
Posted On2017-02-15