Incidental Mutation 'R5897:Agbl3'
ID457585
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene NameATP/GTP binding protein-like 3
Synonyms4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34780432-34859459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34803573 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 494 (I494V)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]
Predicted Effect probably benign
Transcript: ENSMUST00000115016
AA Change: I494V

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: I494V

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115017
AA Change: I489V

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: I489V

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135304
SMART Domains Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143474
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202017
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense not run
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGAGAAATGCGTCCTTATG -3'
(R):5'- GCTGGTCTTAGAATGAGGGATC -3'

Sequencing Primer
(F):5'- GAAATGCGTCCTTATGGAAAACTAG -3'
(R):5'- TGGCCATTTAACAGTTCCAAATAG -3'
Posted On2017-02-15