Incidental Mutation 'R5897:Usp38'
ID457592
Institutional Source Beutler Lab
Gene Symbol Usp38
Ensembl Gene ENSMUSG00000038250
Gene Nameubiquitin specific peptidase 38
Synonyms4833420O05Rik, 4631402N15Rik
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80980733-81014928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81005453 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000039943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042724]
Predicted Effect probably benign
Transcript: ENSMUST00000042724
AA Change: D276G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039943
Gene: ENSMUSG00000038250
AA Change: D276G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 1 365 5e-3 SMART
Pfam:UCH 444 946 1.8e-47 PFAM
Pfam:UCH_1 445 921 2.2e-23 PFAM
low complexity region 995 1006 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211538
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Usp38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Usp38 APN 8 81013840 missense probably damaging 0.99
IGL01373:Usp38 APN 8 80990018 missense possibly damaging 0.80
IGL02089:Usp38 APN 8 80985714 missense possibly damaging 0.48
IGL02528:Usp38 APN 8 80993235 missense probably damaging 1.00
IGL02538:Usp38 APN 8 80985558 missense probably damaging 1.00
IGL02615:Usp38 APN 8 80985151 missense probably benign 0.00
IGL03340:Usp38 APN 8 81012276 missense probably damaging 1.00
P0033:Usp38 UTSW 8 80981896 missense probably benign 0.12
R0313:Usp38 UTSW 8 80984442 nonsense probably null
R0331:Usp38 UTSW 8 80995840 missense probably benign 0.00
R0497:Usp38 UTSW 8 80984424 splice site probably benign
R0594:Usp38 UTSW 8 81005366 missense probably damaging 0.97
R0632:Usp38 UTSW 8 81014150 missense probably benign 0.03
R1355:Usp38 UTSW 8 80985033 missense possibly damaging 0.61
R1500:Usp38 UTSW 8 80995770 missense probably damaging 1.00
R1566:Usp38 UTSW 8 80984803 missense probably benign 0.00
R1880:Usp38 UTSW 8 81001066 missense probably damaging 1.00
R4161:Usp38 UTSW 8 80993338 missense probably damaging 1.00
R4176:Usp38 UTSW 8 80993299 missense probably benign 0.33
R4882:Usp38 UTSW 8 80981977 nonsense probably null
R5344:Usp38 UTSW 8 80985763 missense possibly damaging 0.76
R5481:Usp38 UTSW 8 80993323 missense possibly damaging 0.89
R5564:Usp38 UTSW 8 80985088 missense probably damaging 0.96
R6111:Usp38 UTSW 8 81013922 missense probably damaging 1.00
R6746:Usp38 UTSW 8 81014291 missense possibly damaging 0.80
R6912:Usp38 UTSW 8 80993329 missense probably damaging 1.00
R7051:Usp38 UTSW 8 81001121 missense possibly damaging 0.50
R7483:Usp38 UTSW 8 81014561 start gained probably benign
R7525:Usp38 UTSW 8 81014246 missense probably damaging 1.00
R7565:Usp38 UTSW 8 80981972 missense probably damaging 1.00
R8062:Usp38 UTSW 8 80984589 missense probably damaging 1.00
RF016:Usp38 UTSW 8 81013893 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGACTATCTCTGTCTCACTGGC -3'
(R):5'- GGCCACAGTTACATTCATTGC -3'

Sequencing Primer
(F):5'- GGCTTTGCCCCCAAAACC -3'
(R):5'- GCTCAGTAGTAAATACTGAGTC -3'
Posted On2017-02-15