Incidental Mutation 'R5897:Gje1'
ID457597
Institutional Source Beutler Lab
Gene Symbol Gje1
Ensembl Gene ENSMUSG00000019867
Gene Namegap junction protein, epsilon 1
SynonymsAEY12, connexin 23, Cx23, Gjf1, Gsfaey12
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location14715623-14718214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14716723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 105 (I105N)
Ref Sequence ENSEMBL: ENSMUSP00000020016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020016] [ENSMUST00000190114] [ENSMUST00000191238]
Predicted Effect probably damaging
Transcript: ENSMUST00000020016
AA Change: I105N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020016
Gene: ENSMUSG00000019867
AA Change: I105N

DomainStartEndE-ValueType
Blast:Connexin_CCC 31 74 3e-21 BLAST
Connexin_CCC 125 194 2.75e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188021
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with a mutation in this gene have small eyes. Eye/lens development arrests at the lens vesicle stage, and no primary lens fibers form. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Gje1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Gje1 APN 10 14716669 missense probably damaging 1.00
IGL02579:Gje1 APN 10 14716748 missense probably benign 0.23
IGL03046:Gje1 UTSW 10 14716630 missense probably damaging 1.00
R0884:Gje1 UTSW 10 14716740 missense possibly damaging 0.84
R1444:Gje1 UTSW 10 14716636 intron probably null
R1666:Gje1 UTSW 10 14716807 missense possibly damaging 0.57
R1725:Gje1 UTSW 10 14716424 nonsense probably null
R4841:Gje1 UTSW 10 14717338 missense probably null 1.00
R4842:Gje1 UTSW 10 14717338 missense probably null 1.00
R5048:Gje1 UTSW 10 14717277 missense probably damaging 1.00
R5104:Gje1 UTSW 10 14716718 nonsense probably null
R5421:Gje1 UTSW 10 14716684 missense probably damaging 1.00
R5422:Gje1 UTSW 10 14716684 missense probably damaging 1.00
R6386:Gje1 UTSW 10 14716621 missense probably damaging 1.00
R6930:Gje1 UTSW 10 14718142 missense possibly damaging 0.90
R7426:Gje1 UTSW 10 14716479 missense probably damaging 1.00
R7576:Gje1 UTSW 10 14716757 missense probably damaging 1.00
R7650:Gje1 UTSW 10 14716424 nonsense probably null
R8020:Gje1 UTSW 10 14717277 missense probably damaging 1.00
X0065:Gje1 UTSW 10 14716599 missense possibly damaging 0.82
Z1088:Gje1 UTSW 10 14718124 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGCTCTGGAACCATGCATTTTAG -3'
(R):5'- CCAACCGCCATTATGTTTAAAGTTC -3'

Sequencing Primer
(F):5'- GGAACCATGCATTTTAGAATATTTGG -3'
(R):5'- GTTCTAAAATCATATGTCAGCACCAG -3'
Posted On2017-02-15