Incidental Mutation 'R5897:Rab1a'
ID457602
Institutional Source Beutler Lab
Gene Symbol Rab1a
Ensembl Gene ENSMUSG00000020149
Gene NameRAB1A, member RAS oncogene family
SynonymsYpt1, Rab1, Rab-1, Gtbp, ras-related YPT1 protein
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location20201432-20226856 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 20218867 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 51 (R51*)
Ref Sequence ENSEMBL: ENSMUSP00000127330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020358] [ENSMUST00000109601] [ENSMUST00000109602] [ENSMUST00000163483]
Predicted Effect probably null
Transcript: ENSMUST00000020358
AA Change: R48*
SMART Domains Protein: ENSMUSP00000020358
Gene: ENSMUSG00000020149
AA Change: R48*

DomainStartEndE-ValueType
RAB 9 172 2.9e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109601
AA Change: R48*
SMART Domains Protein: ENSMUSP00000105230
Gene: ENSMUSG00000020149
AA Change: R48*

DomainStartEndE-ValueType
Pfam:Ras 10 63 1.4e-18 PFAM
Pfam:Miro 10 93 8.4e-7 PFAM
Pfam:Ras 61 95 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109602
SMART Domains Protein: ENSMUSP00000105231
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
Pfam:Ras 10 31 7.6e-6 PFAM
Pfam:Ras 29 107 8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152728
Predicted Effect probably null
Transcript: ENSMUST00000163483
AA Change: R51*
SMART Domains Protein: ENSMUSP00000127330
Gene: ENSMUSG00000020149
AA Change: R51*

DomainStartEndE-ValueType
RAB 12 175 2.9e-107 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Rab1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Rab1a APN 11 20224727 missense possibly damaging 0.92
IGL01639:Rab1a APN 11 20223185 splice site probably benign
IGL01982:Rab1a APN 11 20224717 missense probably benign 0.17
R0504:Rab1a UTSW 11 20223169 missense probably damaging 0.99
R1167:Rab1a UTSW 11 20223172 missense possibly damaging 0.93
R2967:Rab1a UTSW 11 20223068 intron probably null
R3703:Rab1a UTSW 11 20224506 splice site probably benign
R5623:Rab1a UTSW 11 20201626 utr 5 prime probably benign
R7864:Rab1a UTSW 11 20215673 nonsense probably null
R7947:Rab1a UTSW 11 20215673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAGCTCTGACAATTACAAAATCC -3'
(R):5'- CTGGGAAATGCCTTTTGGTC -3'

Sequencing Primer
(F):5'- GGTTCAGTCCGTGATCATCAAGAC -3'
(R):5'- GGGAAATGCCTTTTGGTCTAAAATC -3'
Posted On2017-02-15