Incidental Mutation 'R5897:Hsd17b3'
ID 457605
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Name hydroxysteroid (17-beta) dehydrogenase 3
Synonyms 17(beta)HSD type 3
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5897 (G1)
Quality Score 140
Status Not validated
Chromosome 13
Chromosomal Location 64058266-64089230 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 64088985 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
AlphaFold P70385
Predicted Effect probably null
Transcript: ENSMUST00000039832
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166224
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000222783
Predicted Effect probably null
Transcript: ENSMUST00000222810
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5992:Hsd17b3 UTSW 13 64059470 splice site probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
R8743:Hsd17b3 UTSW 13 64062898 missense probably benign 0.00
R8786:Hsd17b3 UTSW 13 64072048 missense probably damaging 1.00
R8904:Hsd17b3 UTSW 13 64064380 missense probably damaging 1.00
R8994:Hsd17b3 UTSW 13 64062881 missense probably damaging 1.00
R9324:Hsd17b3 UTSW 13 64058645 missense possibly damaging 0.49
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGTGAGAACTCGGTACCTCTG -3'
(R):5'- TAAAGACCAGGTCCAGCAGC -3'

Sequencing Primer
(F):5'- AACTCGGTACCTCTGCCTGG -3'
(R):5'- AGGTCCAGCAGCATCTCCAG -3'
Posted On 2017-02-15