Mutagenetix > Incidental Mutations

Incidental Mutation 'R5897:Tcf20'

457609

Institutional Source

Beutler Lab

Gene Symbol

Tcf20

Ensembl Gene

ENSMUSG00000041852

Gene Name

transcription factor 20

Synonyms

stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP

MMRRC Submission

044096-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.698) question?

Stock #

R5897 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82808436-82987872 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 82851783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1822 (C1822*)

Ref Sequence

ENSEMBL: ENSMUSP00000105136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510]

AlphaFold

Q9EPQ8

Predicted Effect

probably null
Transcript: ENSMUST00000048966
AA Change: C1822*

SMART Domains

Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: C1822*

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109510
AA Change: C1822*

SMART Domains

Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: C1822*

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,485,964		probably benign	Het
5430419D17Rik	A	T	7: 131,196,551		probably null	Het
Abi3bp	A	G	16: 56,604,669	T489A	possibly damaging	Het
Adam3	T	C	8: 24,697,228	T416A	probably benign	Het
Agbl3	A	G	6: 34,803,573	I494V	probably benign	Het
Akap9	T	C	5: 4,077,904	S3747P	probably benign	Het
Arhgef18	G	T	8: 3,439,682	R338L	probably damaging	Het
Atg16l1	G	T	1: 87,785,997		probably null	Het
BC024139	A	G	15: 76,126,139	S56P	possibly damaging	Het
Ccdc175	T	A	12: 72,159,804	I223L	probably benign	Het
Cep76	T	A	18: 67,638,328	Q78L	probably benign	Het
Cyp20a1	A	C	1: 60,353,061	N92T	probably damaging	Het
Cyp2c68	T	C	19: 39,712,531	D281G	probably benign	Het
Cyp2j12	T	C	4: 96,102,042	N429S	probably damaging	Het
Dchs2	G	A	3: 83,285,410	V1721I	possibly damaging	Het
Elovl4	G	A	9: 83,790,104	T54M	possibly damaging	Het
Fam13b	A	G	18: 34,454,081	V542A	possibly damaging	Het
Gje1	A	T	10: 14,716,723	I105N	probably damaging	Het
Grm4	G	T	17: 27,435,163	F349L	probably benign	Het
Hsd17b3	A	G	13: 64,088,985		probably null	Het
Khdrbs1	A	T	4: 129,720,655	D368E	probably benign	Het
Klra10	T	A	6: 130,281,829	R32*	probably null	Het
Lrrc7	T	A	3: 158,164,353	I644F	probably damaging	Het
Olfr31	G	T	14: 14,328,120	G3V	probably benign	Het
Olfr94	A	T	17: 37,197,260	L161Q	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pbx3	A	T	2: 34,371,908	S5T	probably benign	Het
Pcdhb13	T	A	18: 37,443,211	V214E	probably benign	Het
Pkd1l1	T	C	11: 8,879,176	D1022G	probably benign	Het
Pla2g4a	T	A	1: 149,865,148	K380I	probably damaging	Het
Prl3b1	A	G	13: 27,245,875	T99A	probably benign	Het
Prr12	C	T	7: 45,043,384	V1575I	probably damaging	Het
Ptpn5	C	T	7: 47,079,514	V451I	probably benign	Het
Rab1a	C	T	11: 20,218,867	R51*	probably null	Het
Skint9	A	G	4: 112,413,916	I99T	possibly damaging	Het
Tbc1d8	A	G	1: 39,392,109	V394A	possibly damaging	Het
Tdrd6	T	A	17: 43,624,877	D1760V	probably damaging	Het
Tinag	C	A	9: 77,045,444	C86F	probably damaging	Het
Tmtc2	A	T	10: 105,413,598	N91K	probably damaging	Het
Tmub1	G	A	5: 24,446,927	T13M	probably benign	Het
Txn2	G	A	15: 77,924,526	A135V	probably benign	Het
Ush2a	G	A	1: 188,821,738	G3475R	probably damaging	Het
Usp38	T	C	8: 81,005,453	D276G	probably benign	Het
Vax1	T	A	19: 59,169,801	I77F	unknown	Het
Vmn2r108	C	T	17: 20,471,318	M314I	probably benign	Het
Vmn2r4	C	A	3: 64,415,266	G11*	probably null	Het
Zcchc14	T	C	8: 121,605,160		probably benign	Het

Other mutations in Tcf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tcf20	APN	15	82854895	missense	probably damaging	1.00
IGL00229:Tcf20	APN	15	82857142	missense	possibly damaging	0.50
IGL00539:Tcf20	APN	15	82852756	missense	probably benign	0.41
IGL00576:Tcf20	APN	15	82856075	missense	probably damaging	1.00
IGL01135:Tcf20	APN	15	82853900	missense	probably benign
IGL01670:Tcf20	APN	15	82855363	missense	possibly damaging	0.77
IGL01684:Tcf20	APN	15	82857160	missense	probably damaging	1.00
IGL01767:Tcf20	APN	15	82856008	missense	probably damaging	1.00
IGL01825:Tcf20	APN	15	82852966	missense	probably benign
IGL01834:Tcf20	APN	15	82855697	missense	probably damaging	0.99
IGL01836:Tcf20	APN	15	82855155	missense	probably damaging	0.99
IGL02415:Tcf20	APN	15	82853459	missense	probably benign	0.28
IGL02731:Tcf20	APN	15	82853237	missense	probably benign	0.00
IGL02739:Tcf20	APN	15	82856080	missense	probably damaging	1.00
IGL03058:Tcf20	APN	15	82852004	missense	probably damaging	0.96
PIT4131001:Tcf20	UTSW	15	82851584	missense	probably damaging	0.96
R0184:Tcf20	UTSW	15	82852300	missense	probably damaging	0.99
R0207:Tcf20	UTSW	15	82855085	missense	probably benign
R0732:Tcf20	UTSW	15	82852303	missense	probably benign	0.07
R1502:Tcf20	UTSW	15	82855576	missense	probably damaging	1.00
R1575:Tcf20	UTSW	15	82855492	missense	probably benign	0.19
R1719:Tcf20	UTSW	15	82852777	missense	probably benign	0.03
R1997:Tcf20	UTSW	15	82857230	nonsense	probably null
R2152:Tcf20	UTSW	15	82855602	missense	probably damaging	1.00
R2173:Tcf20	UTSW	15	82854692	missense	possibly damaging	0.62
R2288:Tcf20	UTSW	15	82851685	missense	probably benign
R4049:Tcf20	UTSW	15	82853429	missense	probably damaging	1.00
R4496:Tcf20	UTSW	15	82854984	missense	probably damaging	1.00
R4704:Tcf20	UTSW	15	82851727	missense	possibly damaging	0.49
R4892:Tcf20	UTSW	15	82854199	missense	possibly damaging	0.80
R5164:Tcf20	UTSW	15	82856603	missense	probably damaging	1.00
R5207:Tcf20	UTSW	15	82856185	missense	probably damaging	0.98
R5219:Tcf20	UTSW	15	82856381	missense	probably damaging	1.00
R5228:Tcf20	UTSW	15	82855955	missense	probably benign	0.01
R5288:Tcf20	UTSW	15	82855709	missense	possibly damaging	0.50
R5374:Tcf20	UTSW	15	82851957	missense	probably damaging	0.99
R5384:Tcf20	UTSW	15	82856199	missense	probably damaging	0.99
R5677:Tcf20	UTSW	15	82853242	missense	probably benign	0.05
R6089:Tcf20	UTSW	15	82853208	missense	probably benign	0.06
R6196:Tcf20	UTSW	15	82851986	missense	possibly damaging	0.89
R6229:Tcf20	UTSW	15	82854880	missense	probably damaging	1.00
R6448:Tcf20	UTSW	15	82852660	missense	probably benign
R6688:Tcf20	UTSW	15	82854535	missense	possibly damaging	0.68
R7009:Tcf20	UTSW	15	82854682	missense	probably benign	0.07
R7051:Tcf20	UTSW	15	82856078	missense	probably damaging	1.00
R7215:Tcf20	UTSW	15	82853489	missense	probably benign
R7486:Tcf20	UTSW	15	82853734	missense	possibly damaging	0.78
R7583:Tcf20	UTSW	15	82855276	missense	possibly damaging	0.82
R7678:Tcf20	UTSW	15	82851565	missense	possibly damaging	0.92
R8090:Tcf20	UTSW	15	82856006	missense	probably damaging	1.00
R8156:Tcf20	UTSW	15	82852937	missense	probably benign	0.00
R8191:Tcf20	UTSW	15	82853405	nonsense	probably null
R8259:Tcf20	UTSW	15	82852273	missense	probably damaging	1.00
R8339:Tcf20	UTSW	15	82852676	missense	probably benign	0.04
R8447:Tcf20	UTSW	15	82853236	missense	possibly damaging	0.77
R8497:Tcf20	UTSW	15	82855951	missense	probably benign	0.07
R8728:Tcf20	UTSW	15	82854957	missense	probably damaging	1.00
R8829:Tcf20	UTSW	15	82855714	missense	probably damaging	1.00
R8861:Tcf20	UTSW	15	82852525	missense	probably damaging	0.99
R9177:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9268:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9294:Tcf20	UTSW	15	82852696	missense	probably benign	0.11
RF019:Tcf20	UTSW	15	82851593	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTAGATTCCATTGGCCCAG -3'
(R):5'- AGCCACTCTTCCGAAGAATC -3'

Sequencing Primer
(F):5'- CATGGACCCAAAATTCGTTGCTG -3'
(R):5'- TCTTCCGAAGAATCCACCTCCTAAG -3'

Posted On

2017-02-15