Incidental Mutation 'R5897:Vmn2r108'
ID457612
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5897 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20471318 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 314 (M314I)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: M314I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: M314I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTGACAGTTAGCCAAAAGTCG -3'
(R):5'- GCATAGCTTTTGTGAAAATGATCCC -3'

Sequencing Primer
(F):5'- TGACAGTTAGCCAAAAGTCGACAATC -3'
(R):5'- TGATCCCTATGACATGGAATGC -3'
Posted On2017-02-15