Incidental Mutation 'R5897:Olfr94'
ID457614
Institutional Source Beutler Lab
Gene Symbol Olfr94
Ensembl Gene ENSMUSG00000043827
Gene Nameolfactory receptor 94
SynonymsMOR256-32P, GA_x6K02T2PSCP-1637650-1636712
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5897 (G1)
Quality Score115
Status Not validated
Chromosome17
Chromosomal Location37196425-37200994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37197260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 161 (L161Q)
Ref Sequence ENSEMBL: ENSMUSP00000153315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038844] [ENSMUST00000055324] [ENSMUST00000222190]
Predicted Effect probably benign
Transcript: ENSMUST00000038844
SMART Domains Protein: ENSMUSP00000035808
Gene: ENSMUSG00000035186

DomainStartEndE-ValueType
UBQ 5 76 8.61e-9 SMART
UBQ 88 158 9.23e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055324
AA Change: L236Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055232
Gene: ENSMUSG00000043827
AA Change: L236Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:7tm_4 105 382 6.5e-39 PFAM
Pfam:7TM_GPCR_Srsx 109 220 2.1e-9 PFAM
Pfam:7tm_1 115 365 3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208837
Predicted Effect probably damaging
Transcript: ENSMUST00000222190
AA Change: L161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vax1 T A 19: 59,169,801 I77F unknown Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Olfr94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr94 APN 17 37196942 missense probably benign 0.03
IGL01413:Olfr94 APN 17 37197663 missense possibly damaging 0.75
ANU23:Olfr94 UTSW 17 37196942 missense probably benign 0.03
R1822:Olfr94 UTSW 17 37196831 unclassified probably benign
R4731:Olfr94 UTSW 17 37197024 missense probably damaging 0.98
R4732:Olfr94 UTSW 17 37197024 missense probably damaging 0.98
R4733:Olfr94 UTSW 17 37197024 missense probably damaging 0.98
R7894:Olfr94 UTSW 17 37197156 missense probably damaging 1.00
R7977:Olfr94 UTSW 17 37197156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAATAGGCAGACCGCGGTC -3'
(R):5'- ATGGCTCAGCTGTGCTCATC -3'

Sequencing Primer
(F):5'- TGAGAGCCACATGTGCTCG -3'
(R):5'- TCAGCTGTGCTCATCGCTGG -3'
Posted On2017-02-15