Incidental Mutation 'R5897:Vax1'
ID457620
Institutional Source Beutler Lab
Gene Symbol Vax1
Ensembl Gene ENSMUSG00000006270
Gene Nameventral anterior homeobox 1
Synonyms
MMRRC Submission 044096-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R5897 (G1)
Quality Score158
Status Not validated
Chromosome19
Chromosomal Location59166187-59170056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59169801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 77 (I77F)
Ref Sequence ENSEMBL: ENSMUSP00000134642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172821]
Predicted Effect unknown
Transcript: ENSMUST00000172821
AA Change: I77F
SMART Domains Protein: ENSMUSP00000134642
Gene: ENSMUSG00000006270
AA Change: I77F

DomainStartEndE-ValueType
HOX 100 162 1.34e-27 SMART
low complexity region 187 206 N/A INTRINSIC
low complexity region 208 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173710
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the EMX homeobox protein family. The encoded protein functions as a transcription factor which is important in the development of anterior ventral forebrain and visual system. Disruption of this gene causes impairment in the developing forebrain, where the encoded protein is necessary for axon guidance and major tract formation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants exhibit cleft palate and most die at birth. A few survive to 2 weeks of age. Mutants display defects in axon guidance, coloboma, dysgenesis of the optic nerve, defects of basal telencephalon, and holoprosencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,485,964 probably benign Het
5430419D17Rik A T 7: 131,196,551 probably null Het
Abi3bp A G 16: 56,604,669 T489A possibly damaging Het
Adam3 T C 8: 24,697,228 T416A probably benign Het
Agbl3 A G 6: 34,803,573 I494V probably benign Het
Akap9 T C 5: 4,077,904 S3747P probably benign Het
Arhgef18 G T 8: 3,439,682 R338L probably damaging Het
Atg16l1 G T 1: 87,785,997 probably null Het
BC024139 A G 15: 76,126,139 S56P possibly damaging Het
Ccdc175 T A 12: 72,159,804 I223L probably benign Het
Cep76 T A 18: 67,638,328 Q78L probably benign Het
Cyp20a1 A C 1: 60,353,061 N92T probably damaging Het
Cyp2c68 T C 19: 39,712,531 D281G probably benign Het
Cyp2j12 T C 4: 96,102,042 N429S probably damaging Het
Dchs2 G A 3: 83,285,410 V1721I possibly damaging Het
Elovl4 G A 9: 83,790,104 T54M possibly damaging Het
Fam13b A G 18: 34,454,081 V542A possibly damaging Het
Gje1 A T 10: 14,716,723 I105N probably damaging Het
Grm4 G T 17: 27,435,163 F349L probably benign Het
Hsd17b3 A G 13: 64,088,985 probably null Het
Khdrbs1 A T 4: 129,720,655 D368E probably benign Het
Klra10 T A 6: 130,281,829 R32* probably null Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Olfr31 G T 14: 14,328,120 G3V probably benign Het
Olfr94 A T 17: 37,197,260 L161Q probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pbx3 A T 2: 34,371,908 S5T probably benign Het
Pcdhb13 T A 18: 37,443,211 V214E probably benign Het
Pkd1l1 T C 11: 8,879,176 D1022G probably benign Het
Pla2g4a T A 1: 149,865,148 K380I probably damaging Het
Prl3b1 A G 13: 27,245,875 T99A probably benign Het
Prr12 C T 7: 45,043,384 V1575I probably damaging Het
Ptpn5 C T 7: 47,079,514 V451I probably benign Het
Rab1a C T 11: 20,218,867 R51* probably null Het
Skint9 A G 4: 112,413,916 I99T possibly damaging Het
Tbc1d8 A G 1: 39,392,109 V394A possibly damaging Het
Tcf20 A T 15: 82,851,783 C1822* probably null Het
Tdrd6 T A 17: 43,624,877 D1760V probably damaging Het
Tinag C A 9: 77,045,444 C86F probably damaging Het
Tmtc2 A T 10: 105,413,598 N91K probably damaging Het
Tmub1 G A 5: 24,446,927 T13M probably benign Het
Txn2 G A 15: 77,924,526 A135V probably benign Het
Ush2a G A 1: 188,821,738 G3475R probably damaging Het
Usp38 T C 8: 81,005,453 D276G probably benign Het
Vmn2r108 C T 17: 20,471,318 M314I probably benign Het
Vmn2r4 C A 3: 64,415,266 G11* probably null Het
Zcchc14 T C 8: 121,605,160 probably benign Het
Other mutations in Vax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4297:Vax1 UTSW 19 59166251 nonsense probably null
R5753:Vax1 UTSW 19 59166382 missense probably benign 0.13
R6063:Vax1 UTSW 19 59168604 missense unknown
R6378:Vax1 UTSW 19 59166224 missense probably benign 0.08
R6874:Vax1 UTSW 19 59168523 missense unknown
R7558:Vax1 UTSW 19 59169984 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCAGAAAGAGCGCTTTGAG -3'
(R):5'- ACAAAATGGACGTCCGGTG -3'

Sequencing Primer
(F):5'- AGCGCTTTGAGAGGAGCC -3'
(R):5'- GGTGCCACTCGGACACC -3'
Posted On2017-02-15