Incidental Mutation 'R5898:Fap'
ID457631
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Namefibroblast activation protein
Synonyms
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5898 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62500943-62574075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62573503 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 9 (F9L)
Ref Sequence ENSEMBL: ENSMUSP00000134386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000173745] [ENSMUST00000174234] [ENSMUST00000174448]
Predicted Effect probably benign
Transcript: ENSMUST00000000402
AA Change: F9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: F9L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102732
AA Change: F9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: F9L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect probably benign
Transcript: ENSMUST00000173745
SMART Domains Protein: ENSMUSP00000134305
Gene: ENSMUSG00000000392

DomainStartEndE-ValueType
Pfam:DPPIV_N 12 63 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174234
AA Change: F9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: F9L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174448
AA Change: F9L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: F9L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0254:Fap UTSW 2 62503402 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R2136:Fap UTSW 2 62524207 missense possibly damaging 0.94
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4517:Fap UTSW 2 62530715 missense probably benign 0.01
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5944:Fap UTSW 2 62542261 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6505:Fap UTSW 2 62546603 nonsense probably null
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
R7138:Fap UTSW 2 62542178 missense probably benign 0.10
R7806:Fap UTSW 2 62503414 missense probably damaging 1.00
R8000:Fap UTSW 2 62502798 critical splice donor site probably null
R8115:Fap UTSW 2 62519041 missense probably benign 0.07
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Z1176:Fap UTSW 2 62528774 missense possibly damaging 0.87
Z1177:Fap UTSW 2 62502446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCTTACACACAACATAACTG -3'
(R):5'- TAGCAGAACTGGAAAGGCTCC -3'

Sequencing Primer
(F):5'- CGTCTTCTTAGAAATAACAGGCTTAC -3'
(R):5'- GGCTCCAGCAATCACCG -3'
Posted On2017-02-15