Incidental Mutation 'R5898:Slc22a5'
ID457677
Institutional Source Beutler Lab
Gene Symbol Slc22a5
Ensembl Gene ENSMUSG00000018900
Gene Namesolute carrier family 22 (organic cation transporter), member 5
SynonymsLstpl, Octn2
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5898 (G1)
Quality Score177
Status Validated
Chromosome11
Chromosomal Location53864542-53891660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53873733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 296 (I296F)
Ref Sequence ENSEMBL: ENSMUSP00000019044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019044] [ENSMUST00000136307] [ENSMUST00000152084]
Predicted Effect probably damaging
Transcript: ENSMUST00000019044
AA Change: I296F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019044
Gene: ENSMUSG00000018900
AA Change: I296F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 57 524 1.7e-28 PFAM
Pfam:MFS_1 138 478 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136307
SMART Domains Protein: ENSMUSP00000118900
Gene: ENSMUSG00000018900

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152084
Meta Mutation Damage Score 0.3913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a spontaneous missense mutation exhibit systemic carnitine deficiency, cardiac hypertrophy, impaired Na-dependent carnitine transport, fatty liver, hypoglycemia, high postnatal mortality, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Slc22a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Slc22a5 APN 11 53867664 missense probably benign 0.39
IGL02063:Slc22a5 APN 11 53875073 missense probably damaging 0.99
IGL03008:Slc22a5 APN 11 53891232 missense probably damaging 1.00
IGL03190:Slc22a5 APN 11 53875014 missense probably benign 0.02
R0055:Slc22a5 UTSW 11 53891206 missense probably benign 0.00
R0190:Slc22a5 UTSW 11 53869415 nonsense probably null
R1498:Slc22a5 UTSW 11 53869314 missense probably damaging 1.00
R1729:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R1784:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R2249:Slc22a5 UTSW 11 53883706 missense possibly damaging 0.73
R3426:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3427:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3428:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3895:Slc22a5 UTSW 11 53865825 missense possibly damaging 0.64
R4582:Slc22a5 UTSW 11 53891209 missense probably damaging 1.00
R4965:Slc22a5 UTSW 11 53891526 missense possibly damaging 0.94
R6018:Slc22a5 UTSW 11 53876020 missense probably damaging 1.00
R6063:Slc22a5 UTSW 11 53867533 missense possibly damaging 0.79
R6218:Slc22a5 UTSW 11 53891618 unclassified probably benign
R6369:Slc22a5 UTSW 11 53891370 missense probably damaging 1.00
R6827:Slc22a5 UTSW 11 53871616 missense possibly damaging 0.92
R7936:Slc22a5 UTSW 11 53869389 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAACACCCCTTGCCTTAGG -3'
(R):5'- TACCTCAGGTAGTTACTGGGC -3'

Sequencing Primer
(F):5'- CTTAGGGGTGGCCATGGC -3'
(R):5'- TTCTGGCTTATGAACACCAGAC -3'
Posted On2017-02-15