Incidental Mutation 'R5898:Rcbtb2'
ID457688
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
SynonymsRc/btb2, Chc1l, 2610028E02Rik, 2810420M18Rik
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5898 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73123037-73207843 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 73161965 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 23 (L23*)
Ref Sequence ENSEMBL: ENSMUSP00000127397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163339] [ENSMUST00000163533] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000165429] [ENSMUST00000165567] [ENSMUST00000165727] [ENSMUST00000167021] [ENSMUST00000167401] [ENSMUST00000169479] [ENSMUST00000169513] [ENSMUST00000170368] [ENSMUST00000170370] [ENSMUST00000170677] [ENSMUST00000171070] [ENSMUST00000171767]
Predicted Effect probably null
Transcript: ENSMUST00000022702
AA Change: L23*
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110952
AA Change: L23*
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163339
Predicted Effect probably null
Transcript: ENSMUST00000163533
AA Change: L23*
SMART Domains Protein: ENSMUSP00000130828
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 150 4.3e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163797
AA Change: L9*
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106
AA Change: L9*

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164298
AA Change: L9*
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106
AA Change: L9*

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164822
AA Change: L23*
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165429
SMART Domains Protein: ENSMUSP00000127258
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 93 143 4.4e-17 PFAM
Pfam:RCC1_2 130 157 5.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165567
AA Change: L23*
SMART Domains Protein: ENSMUSP00000130240
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 5.3e-17 PFAM
Pfam:RCC1_2 154 172 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165727
SMART Domains Protein: ENSMUSP00000128479
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 11 60 2.3e-14 PFAM
Pfam:RCC1 63 90 6e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167021
AA Change: L23*
Predicted Effect probably null
Transcript: ENSMUST00000167401
AA Change: L23*
Predicted Effect probably null
Transcript: ENSMUST00000169479
AA Change: L23*
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169513
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170368
AA Change: L23*
SMART Domains Protein: ENSMUSP00000126276
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 86 9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170370
AA Change: L23*
SMART Domains Protein: ENSMUSP00000130732
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 128 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170677
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171070
AA Change: L23*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171163
Predicted Effect probably null
Transcript: ENSMUST00000171767
AA Change: L23*
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: L23*

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73164782 missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73162019 missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73168103 nonsense probably null
IGL02811:Rcbtb2 APN 14 73174411 missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73178469 missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73178547 missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73178429 splice site probably benign
R1298:Rcbtb2 UTSW 14 73162388 missense probably damaging 0.99
R1567:Rcbtb2 UTSW 14 73162462 missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73174386 splice site probably benign
R2137:Rcbtb2 UTSW 14 73162051 missense probably damaging 1.00
R2218:Rcbtb2 UTSW 14 73178565 critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73173905 missense probably damaging 1.00
R5832:Rcbtb2 UTSW 14 73166822 missense possibly damaging 0.95
R6484:Rcbtb2 UTSW 14 73177050 missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73166780 missense probably damaging 1.00
R7654:Rcbtb2 UTSW 14 73174501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATGTGGGTGACTCTCAG -3'
(R):5'- AGCAAACTGCCTCGTCACAG -3'

Sequencing Primer
(F):5'- GGTGACTCTCAGCAACACACAG -3'
(R):5'- CCCTGGATGTCTTCAATTTACAAATC -3'
Posted On2017-02-15