Mutagenetix > Incidental Mutations

Incidental Mutation 'R5898:Psmb9'

457697

Institutional Source

Beutler Lab

Gene Symbol

Psmb9

Ensembl Gene

ENSMUSG00000096727

Gene Name

proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)

Synonyms

Lmp2, Lmp-2

MMRRC Submission

044097-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R5898 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

34181988-34187764 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34182292 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 198 (I198F)

Ref Sequence

ENSEMBL: ENSMUSP00000133499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171321] [ENSMUST00000173831] [ENSMUST00000174576]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114230

Predicted Effect

probably benign
Transcript: ENSMUST00000171321

Predicted Effect

probably benign
Transcript: ENSMUST00000173831

SMART Domains

Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

Domain	Start	End	E-Value	Type
Pfam:Proteasome	1	64	2.3e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174576
AA Change: I198F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727
AA Change: I198F

Domain	Start	End	E-Value	Type
Pfam:Proteasome	17	198	1.2e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179593

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.8%

Validation Efficiency

96% (86/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a grossly normal phenotype but suffer from increased susceptibility to some viruses and have an increased risk of tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	G	T	10: 100,612,900	R158L	possibly damaging	Het
1700017N19Rik	G	A	10: 100,615,208	M179I	probably benign	Het
5430419D17Rik	T	G	7: 131,241,967		probably null	Het
Abhd12	T	C	2: 150,839,778	I231V	possibly damaging	Het
Adsl	A	G	15: 80,961,353		probably null	Het
Ahnak	C	A	19: 9,013,767	N4138K	possibly damaging	Het
Ahnak	T	C	19: 9,018,211	S5620P	probably damaging	Het
Akap13	C	T	7: 75,729,146	T2145I	probably damaging	Het
Alpk2	T	A	18: 65,307,623	Q700L	probably damaging	Het
Apobec1	T	C	6: 122,580,773	Y159C	probably damaging	Het
Atg9a	T	C	1: 75,186,272	T395A	probably damaging	Het
Atp6v1f	A	G	6: 29,467,958	I48V	probably benign	Het
BC051665	A	C	13: 60,782,704	V278G	probably damaging	Het
Bicd1	A	T	6: 149,513,703	H638L	probably damaging	Het
Cacna2d4	A	G	6: 119,274,231	Y460C	probably damaging	Het
Ccdc157	C	A	11: 4,144,538	R496L	probably benign	Het
Cep44	C	G	8: 56,541,021	V174L	probably damaging	Het
Clca1	G	T	3: 145,016,761	F283L	possibly damaging	Het
Csk	T	C	9: 57,630,302	T110A	probably benign	Het
Cspg4	T	A	9: 56,885,222		probably null	Het
Cutc	A	G	19: 43,760,029	I124V	probably benign	Het
Cyp2d9	A	G	15: 82,455,524	T104A	probably benign	Het
Cyp2j9	G	T	4: 96,577,714	T294K	probably benign	Het
D630003M21Rik	T	A	2: 158,204,657		probably null	Het
Dcaf15	G	T	8: 84,098,452	F450L	probably damaging	Het
Ddhd1	A	T	14: 45,602,668	I723K	probably damaging	Het
Dnah17	C	T	11: 118,114,213	A782T	probably benign	Het
Dnah3	T	C	7: 120,078,501	D399G	probably benign	Het
Dync2h1	T	C	9: 7,148,717	N909S	probably benign	Het
Erbin	A	G	13: 103,839,305		probably null	Het
Fanci	G	A	7: 79,433,321	V682I	probably benign	Het
Fap	A	T	2: 62,573,503	F9L	probably benign	Het
Fat3	T	C	9: 15,938,461	I3882V	probably benign	Het
Fkbp15	A	T	4: 62,326,057		probably null	Het
Fsd2	T	C	7: 81,537,227	Y601C	probably damaging	Het
Gm5900	T	C	7: 104,950,261		noncoding transcript	Het
Gramd4	G	T	15: 86,100,784	G82V	probably damaging	Het
Hc	C	T	2: 34,997,437	V1352I	probably benign	Het
Hsph1	A	T	5: 149,625,158	N466K	probably damaging	Het
Ice2	T	A	9: 69,408,262	D133E	probably benign	Het
Ifi213	T	C	1: 173,568,979	M510V	probably benign	Het
Itpkb	T	G	1: 180,421,315	L861R	probably damaging	Het
Kbtbd3	T	A	9: 4,330,476	D283E	probably damaging	Het
Man2a1	A	G	17: 64,625,380	K154R	probably benign	Het
Masp1	T	A	16: 23,491,927	I252F	probably damaging	Het
Megf11	G	T	9: 64,685,964	C586F	probably damaging	Het
Myh2	C	A	11: 67,192,719	A1476E	possibly damaging	Het
Myo18b	A	T	5: 112,802,330		probably null	Het
Naip6	A	T	13: 100,299,321	V898E	possibly damaging	Het
Nav1	T	C	1: 135,585,146	M59V	probably benign	Het
Nlrp3	A	T	11: 59,546,852	Y119F	probably benign	Het
Oxa1l	T	A	14: 54,363,301	I77N	possibly damaging	Het
Pcdhb8	T	A	18: 37,357,484	D738E	possibly damaging	Het
Pdia5	A	T	16: 35,422,965	W269R	probably damaging	Het
Peak1	T	A	9: 56,207,338	T1440S	probably benign	Het
Piezo1	A	G	8: 122,487,943	V1547A	probably benign	Het
Pkp1	T	C	1: 135,882,521	Y437C	probably damaging	Het
Pla2r1	T	C	2: 60,422,760	D1329G	probably damaging	Het
Ppip5k2	T	C	1: 97,744,162		probably benign	Het
Prrg4	C	T	2: 104,845,033	S75N	probably benign	Het
Rcbtb2	T	A	14: 73,161,965	L23*	probably null	Het
Sbno1	A	T	5: 124,386,791		probably benign	Het
Scn3a	T	C	2: 65,514,695	E483G	probably damaging	Het
Sdccag8	T	A	1: 176,824,822	D46E	probably benign	Het
Selenov	A	G	7: 28,288,154	F293L	probably damaging	Het
Sept2	A	C	1: 93,479,301	D20A	probably benign	Het
Shc1	T	A	3: 89,426,967	Y313*	probably null	Het
Siglec1	T	A	2: 131,073,633	Y1346F	probably damaging	Het
Slc22a5	T	A	11: 53,873,733	I296F	probably damaging	Het
Slc9c1	A	G	16: 45,544,760	N152S	probably damaging	Het
Smoc1	C	T	12: 81,104,757	R83*	probably null	Het
Ssx2ip	A	G	3: 146,427,831	D227G	possibly damaging	Het
Tbrg4	T	C	11: 6,617,372	D576G	probably damaging	Het
Tbx20	T	A	9: 24,758,859	Y226F	probably damaging	Het
Trav10d	G	T	14: 52,811,472	A107S	probably damaging	Het
Trim60	A	T	8: 65,000,364	L411*	probably null	Het
Ttbk2	A	T	2: 120,745,040	V1083D	probably benign	Het
Unc93a	T	A	17: 13,125,577	Q26L	probably damaging	Het
Usp14	T	A	18: 10,022,819	N65I	possibly damaging	Het
Vip	A	T	10: 5,643,988	S114C	probably damaging	Het
Vmn1r237	A	T	17: 21,314,551	I179F	probably damaging	Het
Wdr47	T	A	3: 108,637,885		probably null	Het
Zfp975	A	T	7: 42,662,539	C217S	probably damaging	Het

Other mutations in Psmb9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02008:Psmb9	APN	17	34183679	missense	probably damaging	1.00
bias	UTSW	17	34183225	nonsense	probably null
preconception	UTSW	17	34183614	critical splice donor site	probably null
R0021:Psmb9	UTSW	17	34184303	missense	probably benign	0.26
R0105:Psmb9	UTSW	17	34187275	missense	probably benign
R0477:Psmb9	UTSW	17	34182264	missense	probably damaging	0.99
R3919:Psmb9	UTSW	17	34183614	critical splice donor site	probably null
R5943:Psmb9	UTSW	17	34184291	missense	probably damaging	0.99
R6408:Psmb9	UTSW	17	34185733	missense	probably damaging	1.00
R6919:Psmb9	UTSW	17	34183225	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACACCGTGTCTCTCTGATAC -3'
(R):5'- TTGGACAATGTGTGCTAGCC -3'

Sequencing Primer
(F):5'- GTGTCTCTCTGATACACATATTTCAC -3'
(R):5'- GTGAATCCTCTACAGCCA -3'

Posted On

2017-02-15