Incidental Mutation 'R5899:Cflar'
ID457706
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene NameCASP8 and FADD-like apoptosis regulator
SynonymsFlip, 2310024N18Rik, A430105C05Rik, Cash, Casper, c-Flip
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5899 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58711508-58758884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58752768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 410 (D410G)
Ref Sequence ENSEMBL: ENSMUSP00000109952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114313]
Predicted Effect probably benign
Transcript: ENSMUST00000069333
AA Change: D410G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: D410G

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097722
AA Change: D413G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: D413G

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114313
AA Change: D410G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: D410G

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140940
Meta Mutation Damage Score 0.2701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58732310 missense probably benign 0.42
IGL00959:Cflar APN 1 58729162 critical splice donor site probably null
IGL02045:Cflar APN 1 58752744 missense probably benign 0.25
IGL02200:Cflar APN 1 58752669 missense probably damaging 1.00
IGL02382:Cflar APN 1 58752681 missense probably benign 0.14
IGL03032:Cflar APN 1 58741020 missense probably damaging 1.00
Channel_islands UTSW 1 58753851 missense probably benign 0.00
IGL02988:Cflar UTSW 1 58741031 missense possibly damaging 0.58
R1936:Cflar UTSW 1 58752625 nonsense probably null
R2259:Cflar UTSW 1 58729121 missense probably benign 0.16
R2269:Cflar UTSW 1 58741047 critical splice donor site probably null
R3816:Cflar UTSW 1 58752423 missense probably benign 0.24
R3824:Cflar UTSW 1 58735697 missense probably benign 0.00
R4232:Cflar UTSW 1 58740993 missense possibly damaging 0.92
R4644:Cflar UTSW 1 58731267 missense probably damaging 1.00
R4749:Cflar UTSW 1 58740272 missense possibly damaging 0.62
R4765:Cflar UTSW 1 58732321 missense probably damaging 0.98
R4785:Cflar UTSW 1 58752567 missense probably benign 0.34
R5315:Cflar UTSW 1 58753802 missense probably benign 0.34
R5418:Cflar UTSW 1 58752651 missense possibly damaging 0.54
R5509:Cflar UTSW 1 58752392 missense probably benign 0.02
R5858:Cflar UTSW 1 58753851 missense probably benign 0.00
R6048:Cflar UTSW 1 58741043 missense probably benign 0.02
R7065:Cflar UTSW 1 58731209 missense probably damaging 1.00
R7144:Cflar UTSW 1 58753848 missense
R7206:Cflar UTSW 1 58740991 missense
R7384:Cflar UTSW 1 58752576 missense
R7453:Cflar UTSW 1 58753797 missense
R7467:Cflar UTSW 1 58726438 start codon destroyed probably null
R7694:Cflar UTSW 1 58752807 missense
R7808:Cflar UTSW 1 58711581 start gained probably benign
R7890:Cflar UTSW 1 58752756 missense
R7973:Cflar UTSW 1 58752756 missense
R8073:Cflar UTSW 1 58752822 missense
Z1176:Cflar UTSW 1 58731229 missense
Z1176:Cflar UTSW 1 58740313 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTCAGAGGGAAGCCAAAG -3'
(R):5'- CCCCAAAGCAATTTGAACTGG -3'

Sequencing Primer
(F):5'- AATGTGGACTCTAAGCCC -3'
(R):5'- AAAGTCTCTGTCCTGTCGAAG -3'
Posted On2017-02-15