Incidental Mutation 'R5899:Il2ra'
ID457708
Institutional Source Beutler Lab
Gene Symbol Il2ra
Ensembl Gene ENSMUSG00000026770
Gene Nameinterleukin 2 receptor, alpha chain
SynonymsCD25, Ly-43, Il2r, IL-2R alpha chain
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5899 (G1)
Quality Score196
Status Validated
Chromosome2
Chromosomal Location11642807-11693193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11684437 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 259 (H259R)
Ref Sequence ENSEMBL: ENSMUSP00000028111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028111]
Predicted Effect probably benign
Transcript: ENSMUST00000028111
AA Change: H259R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028111
Gene: ENSMUSG00000026770
AA Change: H259R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 24 77 5e-2 SMART
CCP 121 180 1.2e-4 SMART
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195427
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit massive proliferation of polyclonal T and B cells as adults and develop autoimmune disorders including inflammatory bowel disease and hemolytic anemia with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Il2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Il2ra APN 2 11683099 missense probably benign 0.12
IGL01393:Il2ra APN 2 11683054 missense probably damaging 0.99
IGL01594:Il2ra APN 2 11680396 missense possibly damaging 0.85
IGL02519:Il2ra APN 2 11683090 missense possibly damaging 0.91
R0206:Il2ra UTSW 2 11682017 splice site probably benign
R0208:Il2ra UTSW 2 11682017 splice site probably benign
R0635:Il2ra UTSW 2 11680366 missense probably benign 0.38
R0666:Il2ra UTSW 2 11643073 splice site probably benign
R4732:Il2ra UTSW 2 11676920 missense probably benign
R4733:Il2ra UTSW 2 11676920 missense probably benign
R4959:Il2ra UTSW 2 11676853 missense possibly damaging 0.91
R5006:Il2ra UTSW 2 11674346 missense possibly damaging 0.83
R5531:Il2ra UTSW 2 11676892 missense possibly damaging 0.91
R6145:Il2ra UTSW 2 11680246 missense probably damaging 1.00
R6184:Il2ra UTSW 2 11647979 intron probably benign
R6449:Il2ra UTSW 2 11680362 missense probably benign
R6472:Il2ra UTSW 2 11681969 missense possibly damaging 0.91
R7300:Il2ra UTSW 2 11676910 missense not run
R7371:Il2ra UTSW 2 11643020 missense probably benign 0.07
R7855:Il2ra UTSW 2 11680336 missense possibly damaging 0.65
R7938:Il2ra UTSW 2 11680336 missense possibly damaging 0.65
Z1176:Il2ra UTSW 2 11681931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGGTCCTTGATCACCTAC -3'
(R):5'- CGTGTGTCAGGGAGTAAATGAC -3'

Sequencing Primer
(F):5'- CAGAATTTTCTCACCTGATCTACAG -3'
(R):5'- ATAGAGTCTCCTGATCAACCTGG -3'
Posted On2017-02-15