Incidental Mutation 'R5899:Bpifb2'
ID 457713
Institutional Source Beutler Lab
Gene Symbol Bpifb2
Ensembl Gene ENSMUSG00000027481
Gene Name BPI fold containing family B, member 2
Synonyms 2310069A01Rik, Bpil1, 2310034L21Rik
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R5899 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 153875045-153895270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153891130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 378 (K378E)
Ref Sequence ENSEMBL: ENSMUSP00000028983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028983]
AlphaFold Q8C1E1
Predicted Effect probably damaging
Transcript: ENSMUST00000028983
AA Change: K378E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028983
Gene: ENSMUSG00000027481
AA Change: K378E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 36 194 2.4e-27 PFAM
BPI2 253 456 2.67e-26 SMART
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Bpifb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Bpifb2 APN 2 153891275 splice site probably benign
IGL02164:Bpifb2 APN 2 153883562 missense probably damaging 0.99
IGL03063:Bpifb2 APN 2 153889124 missense probably damaging 1.00
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0084:Bpifb2 UTSW 2 153891091 missense probably benign 0.03
R0791:Bpifb2 UTSW 2 153878519 missense probably benign 0.05
R1503:Bpifb2 UTSW 2 153889510 missense possibly damaging 0.83
R2278:Bpifb2 UTSW 2 153878479 nonsense probably null
R3810:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R3812:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R4030:Bpifb2 UTSW 2 153891317 missense probably benign 0.30
R4573:Bpifb2 UTSW 2 153889492 missense probably damaging 0.99
R4713:Bpifb2 UTSW 2 153881193 missense probably damaging 0.98
R5143:Bpifb2 UTSW 2 153878504 missense probably damaging 1.00
R5523:Bpifb2 UTSW 2 153875985 unclassified probably benign
R6011:Bpifb2 UTSW 2 153889576 splice site probably null
R6172:Bpifb2 UTSW 2 153890412 missense probably benign 0.15
R6378:Bpifb2 UTSW 2 153891152 missense possibly damaging 0.93
R6878:Bpifb2 UTSW 2 153875912 unclassified probably benign
R7381:Bpifb2 UTSW 2 153892348 missense probably benign 0.01
R7390:Bpifb2 UTSW 2 153889806 missense possibly damaging 0.89
R7424:Bpifb2 UTSW 2 153890540 missense possibly damaging 0.93
R7473:Bpifb2 UTSW 2 153881196 missense possibly damaging 0.80
R7493:Bpifb2 UTSW 2 153889477 missense possibly damaging 0.74
R8145:Bpifb2 UTSW 2 153891312 missense probably damaging 1.00
R8178:Bpifb2 UTSW 2 153891956 missense probably damaging 0.99
R8725:Bpifb2 UTSW 2 153889436 missense possibly damaging 0.47
R8960:Bpifb2 UTSW 2 153889126 missense possibly damaging 0.90
R9201:Bpifb2 UTSW 2 153891983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCTGGAAGGATCCCAGGGAAG -3'
(R):5'- AACAGAGCCCACATTGGAGG -3'

Sequencing Primer
(F):5'- AGGGCCCCCACATGTCATC -3'
(R):5'- CACATTGGAGGTGGCCACAG -3'
Posted On 2017-02-15