Incidental Mutation 'R5899:Cdk5rap2'
ID 457718
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 044098-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R5899 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 70161830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124251
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144099
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,876,465 (GRCm39) I792T probably benign Het
Anks1b T A 10: 90,759,379 (GRCm39) probably null Het
Ano3 T G 2: 110,693,232 (GRCm39) D122A probably benign Het
Atp12a T C 14: 56,610,801 (GRCm39) V315A probably benign Het
B230104I21Rik G T 4: 154,433,986 (GRCm39) G57* probably null Het
Bpifb2 A G 2: 153,733,050 (GRCm39) K378E probably damaging Het
Ceacam23 A G 7: 17,651,369 (GRCm39) D840G possibly damaging Het
Cflar A G 1: 58,791,927 (GRCm39) D410G probably benign Het
Clcn6 A G 4: 148,102,049 (GRCm39) V345A probably benign Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Ddx50 T A 10: 62,476,596 (GRCm39) K226* probably null Het
Dnah5 T C 15: 28,448,513 (GRCm39) V4192A possibly damaging Het
Dnah8 G A 17: 30,875,659 (GRCm39) D494N probably benign Het
Dock7 A T 4: 98,879,660 (GRCm39) C965S probably benign Het
Dst C T 1: 34,334,370 (GRCm39) A5083V probably damaging Het
E130208F15Rik T C 7: 30,021,726 (GRCm39) Q10R probably damaging Het
Fbxw15 T C 9: 109,384,741 (GRCm39) probably null Het
Fxr2 A G 11: 69,543,511 (GRCm39) N671D probably damaging Het
Gbp7 A G 3: 142,252,303 (GRCm39) T629A probably benign Het
Grm1 T C 10: 10,565,092 (GRCm39) Y1072C probably benign Het
Hmcn2 A T 2: 31,244,685 (GRCm39) E714V possibly damaging Het
Hsd17b13 T A 5: 104,113,730 (GRCm39) E205D probably benign Het
Igf2bp3 A G 6: 49,094,084 (GRCm39) probably benign Het
Il2ra A G 2: 11,689,248 (GRCm39) H259R probably benign Het
Klk15 G T 7: 43,588,247 (GRCm39) R185L probably benign Het
Map3k11 T G 19: 5,745,937 (GRCm39) probably null Het
Morn3 A G 5: 123,179,166 (GRCm39) W95R probably damaging Het
Nipbl A G 15: 8,364,328 (GRCm39) probably null Het
Nrap A T 19: 56,329,006 (GRCm39) V1145D possibly damaging Het
Or1e35 A G 11: 73,797,755 (GRCm39) S188P probably damaging Het
Or2l13b C T 16: 19,349,551 (GRCm39) G40R probably damaging Het
Or9k2 T A 10: 129,998,542 (GRCm39) I218F probably benign Het
Pdcd11 A G 19: 47,093,198 (GRCm39) N492S possibly damaging Het
Ptgfr C T 3: 151,540,738 (GRCm39) V257I probably damaging Het
Racgap1 T C 15: 99,521,509 (GRCm39) E549G possibly damaging Het
Rfx3 T C 19: 27,808,165 (GRCm39) T193A probably damaging Het
Rplp0 T A 5: 115,699,489 (GRCm39) I149N probably benign Het
Samd7 T G 3: 30,810,883 (GRCm39) I300S probably benign Het
Scpep1 A G 11: 88,825,402 (GRCm39) probably null Het
Senp6 T C 9: 80,049,352 (GRCm39) probably benign Het
Serpinb2 G T 1: 107,447,446 (GRCm39) G78V probably damaging Het
Sesn1 T C 10: 41,687,189 (GRCm39) S58P probably benign Het
Skic3 A G 13: 76,259,938 (GRCm39) probably null Het
Spg11 T C 2: 121,928,680 (GRCm39) D591G possibly damaging Het
Spire2 A C 8: 124,080,833 (GRCm39) S26R probably damaging Het
Strip2 T A 6: 29,956,957 (GRCm39) probably benign Het
Ttn G A 2: 76,697,519 (GRCm39) probably benign Het
Vmn2r77 A G 7: 86,460,924 (GRCm39) Y750C probably damaging Het
Wnt11 T A 7: 98,488,383 (GRCm39) Y23* probably null Het
Zbp1 T A 2: 173,052,340 (GRCm39) D272V probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCTACCTGCTCAGTTCC -3'
(R):5'- ACAGGCCCCTTTCATTTCAGTG -3'

Sequencing Primer
(F):5'- ACCTGCTCAGTTCCTGGCG -3'
(R):5'- AATCTGCAGCCTTGATGTTGACAG -3'
Posted On 2017-02-15