Mutagenetix > Incidental Mutation

Incidental Mutation 'R0558:Abcc2'

45772

Institutional Source

Beutler Lab

Gene Symbol

Abcc2

Ensembl Gene

ENSMUSG00000025194

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 2

Synonyms

multidrug resistance protein 2, Cmoat, Mrp2

MMRRC Submission

038750-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43782192-43840740 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43800724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 273 (G273R)

Ref Sequence

ENSEMBL: ENSMUSP00000026208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026208]

AlphaFold

Q8VI47

Predicted Effect

probably benign
Transcript: ENSMUST00000026208
AA Change: G273R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: G273R

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	63	85	N/A	INTRINSIC
transmembrane domain	100	116	N/A	INTRINSIC
transmembrane domain	128	150	N/A	INTRINSIC
transmembrane domain	160	182	N/A	INTRINSIC
Pfam:ABC_membrane	319	591	3.4e-37	PFAM
low complexity region	597	608	N/A	INTRINSIC
AAA	661	836	1.77e-8	SMART
low complexity region	906	933	N/A	INTRINSIC
Pfam:ABC_membrane	977	1249	5.4e-48	PFAM
AAA	1324	1509	1.33e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129943

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	T	C	17: 25,947,549	N338S	probably benign	Het
Adamts10	T	C	17: 33,550,609	V935A	probably benign	Het
Anapc15-ps	T	C	10: 95,673,121	D90G	probably damaging	Het
Atic	T	A	1: 71,563,788	V107E	probably benign	Het
Atp4b	T	C	8: 13,393,523	T52A	possibly damaging	Het
Cacna1h	C	T	17: 25,381,550	A1606T	probably damaging	Het
Cacng6	T	A	7: 3,434,808	Y217*	probably null	Het
Cc2d2a	T	G	5: 43,724,387		probably benign	Het
Cd226	T	A	18: 89,207,214	H78Q	probably benign	Het
Cers3	A	G	7: 66,783,418	D161G	probably damaging	Het
Ces1f	T	C	8: 93,275,389	H37R	probably benign	Het
Chek1	T	A	9: 36,712,115	N421I	possibly damaging	Het
Cma2	T	C	14: 55,972,792	Y45H	probably damaging	Het
Cmas	C	A	6: 142,775,244	Y401*	probably null	Het
Cyp2j8	A	T	4: 96,444,634	S492T	probably benign	Het
Dnah12	T	C	14: 26,709,310	S358P	probably benign	Het
Dnajc13	T	C	9: 104,201,952		probably null	Het
Ep400	A	C	5: 110,685,067		probably benign	Het
Fam209	T	A	2: 172,472,838	N82K	probably benign	Het
Fam92a	T	C	4: 12,164,095	D248G	probably damaging	Het
G3bp2	A	T	5: 92,073,197	Y20N	probably damaging	Het
Gli2	T	C	1: 118,837,649	D924G	probably benign	Het
Gm10787	T	C	10: 77,022,016		noncoding transcript	Het
Gm11568	A	G	11: 99,858,046	R26G	unknown	Het
Gm4788	A	G	1: 139,739,492	V376A	probably damaging	Het
Hivep3	T	G	4: 120,096,566	L693R	probably damaging	Het
Hook1	A	G	4: 95,993,212		probably benign	Het
Ibtk	A	C	9: 85,737,538	D116E	probably damaging	Het
Insrr	C	T	3: 87,810,981	T927I	possibly damaging	Het
Irx1	T	G	13: 71,959,628	S312R	probably benign	Het
Itga11	T	C	9: 62,752,288	Y441H	probably benign	Het
Itsn1	A	G	16: 91,899,623	D38G	possibly damaging	Het
Kat6b	G	T	14: 21,669,421	E1280D	probably benign	Het
Kcnk10	T	A	12: 98,436,301	Y293F	possibly damaging	Het
Krt74	T	A	15: 101,760,963		noncoding transcript	Het
Lars	T	G	18: 42,214,837	I974L	probably benign	Het
Limch1	A	G	5: 66,969,155	D42G	probably damaging	Het
Mau2	G	C	8: 70,042,432	T85R	probably damaging	Het
Mkrn3	A	G	7: 62,418,864	I393T	probably benign	Het
Mpl	A	C	4: 118,444,020	S541R	probably damaging	Het
Nfrkb	T	C	9: 31,410,268	S754P	possibly damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1233	A	G	2: 89,340,236	L22P	probably benign	Het
Olfr1350	T	C	7: 6,570,653	Y221H	possibly damaging	Het
Olfr1537	T	A	9: 39,238,200	T75S	probably damaging	Het
P2rx7	A	T	5: 122,673,798	I391F	possibly damaging	Het
Pbrm1	T	A	14: 31,085,059		probably null	Het
Pcdh8	T	C	14: 79,770,076	D349G	probably damaging	Het
Pias1	A	G	9: 62,882,009	S639P	possibly damaging	Het
Pkhd1l1	A	T	15: 44,484,424	I232F	probably damaging	Het
Plxnc1	C	T	10: 94,837,935	R995Q	probably damaging	Het
Pnliprp2	T	A	19: 58,774,087	S375T	probably benign	Het
Prkar1b	C	T	5: 139,020,092	V313M	probably benign	Het
Ptpn13	T	C	5: 103,529,717	S734P	probably damaging	Het
Rdh1	T	C	10: 127,759,941	W2R	possibly damaging	Het
Rsph10b	A	T	5: 143,949,338	I285L	probably benign	Het
Rubcnl	T	C	14: 75,047,547	F502S	probably damaging	Het
Ryr2	T	A	13: 11,638,443	I3693F	probably damaging	Het
Ryr2	T	C	13: 11,799,861	Y675C	probably damaging	Het
Scaper	T	C	9: 55,685,923	T477A	probably benign	Het
Scn2a	G	T	2: 65,711,925	V791L	probably benign	Het
Sdk1	A	T	5: 142,132,065	T1573S	probably damaging	Het
Sema3c	A	T	5: 17,714,415	H483L	probably benign	Het
Sema6c	T	C	3: 95,168,691	S219P	probably damaging	Het
Slc10a5	T	G	3: 10,335,117	E161A	probably damaging	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc34a3	C	T	2: 25,233,065		probably benign	Het
Slc38a9	A	T	13: 112,729,196		probably null	Het
Taok1	A	C	11: 77,559,844	S367R	possibly damaging	Het
Tlr6	G	A	5: 64,954,860	Q235*	probably null	Het
Top2a	A	G	11: 98,996,839	V1281A	probably benign	Het
Tpgs1	T	C	10: 79,675,782	Y253H	probably damaging	Het
Tubgcp3	T	C	8: 12,653,462	T288A	probably benign	Het
Ubr4	A	G	4: 139,426,902	E2140G	probably benign	Het
Uso1	A	G	5: 92,174,019	Q257R	probably benign	Het
Zfp106	A	G	2: 120,532,196	V48A	probably damaging	Het
Zfp174	T	A	16: 3,848,254	S128T	possibly damaging	Het
Zscan26	T	A	13: 21,445,055	D426V	probably benign	Het

Other mutations in Abcc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Abcc2	APN	19	43784202	missense	probably benign	0.39
IGL01611:Abcc2	APN	19	43826629	missense	probably damaging	1.00
IGL01800:Abcc2	APN	19	43784295	missense	possibly damaging	0.78
IGL02008:Abcc2	APN	19	43821750	splice site	probably benign
IGL02041:Abcc2	APN	19	43784235	missense	probably damaging	1.00
IGL02528:Abcc2	APN	19	43798504	missense	probably benign
IGL02950:Abcc2	APN	19	43825967	missense	possibly damaging	0.83
IGL03081:Abcc2	APN	19	43782402	utr 5 prime	probably benign
IGL03397:Abcc2	APN	19	43784304	missense	probably benign	0.00
loser	UTSW	19	43839411	utr 3 prime	probably benign
nelson	UTSW	19	43803739	missense	probably benign	0.07
Sore	UTSW	19	43798194	missense	probably benign	0.22
BB002:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
BB012:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
PIT4453001:Abcc2	UTSW	19	43803782	nonsense	probably null
PIT4519001:Abcc2	UTSW	19	43819397	missense	possibly damaging	0.81
R0197:Abcc2	UTSW	19	43826614	nonsense	probably null
R0326:Abcc2	UTSW	19	43825947	missense	possibly damaging	0.90
R0391:Abcc2	UTSW	19	43821605	splice site	probably benign
R0577:Abcc2	UTSW	19	43819401	missense	probably damaging	1.00
R0787:Abcc2	UTSW	19	43798516	critical splice donor site	probably null
R1189:Abcc2	UTSW	19	43819413	missense	probably damaging	1.00
R1200:Abcc2	UTSW	19	43833987	missense	probably damaging	0.98
R1395:Abcc2	UTSW	19	43833940	missense	probably benign	0.22
R1606:Abcc2	UTSW	19	43836652	missense	probably damaging	1.00
R1775:Abcc2	UTSW	19	43798419	missense	possibly damaging	0.88
R1797:Abcc2	UTSW	19	43814786	missense	possibly damaging	0.81
R1797:Abcc2	UTSW	19	43833987	missense	probably damaging	0.98
R1826:Abcc2	UTSW	19	43822014	missense	probably benign	0.01
R1882:Abcc2	UTSW	19	43798506	missense	probably benign	0.00
R1913:Abcc2	UTSW	19	43807244	missense	probably benign	0.10
R1986:Abcc2	UTSW	19	43829879	missense	probably damaging	1.00
R1991:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R1992:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R2006:Abcc2	UTSW	19	43805061	missense	probably damaging	1.00
R2057:Abcc2	UTSW	19	43818038	missense	probably damaging	1.00
R3709:Abcc2	UTSW	19	43798446	missense	possibly damaging	0.80
R3802:Abcc2	UTSW	19	43821626	missense	probably benign	0.01
R4010:Abcc2	UTSW	19	43829864	missense	possibly damaging	0.75
R4014:Abcc2	UTSW	19	43823120	missense	probably benign
R4064:Abcc2	UTSW	19	43804993	nonsense	probably null
R4296:Abcc2	UTSW	19	43823074	missense	probably damaging	1.00
R4296:Abcc2	UTSW	19	43823075	missense	probably damaging	1.00
R4363:Abcc2	UTSW	19	43799136	missense	possibly damaging	0.94
R4580:Abcc2	UTSW	19	43811119	missense	probably damaging	1.00
R4625:Abcc2	UTSW	19	43803739	missense	probably benign	0.07
R4631:Abcc2	UTSW	19	43814707	missense	possibly damaging	0.70
R4671:Abcc2	UTSW	19	43800718	missense	probably benign
R4715:Abcc2	UTSW	19	43816882	missense	possibly damaging	0.54
R4726:Abcc2	UTSW	19	43832114	missense	probably benign	0.23
R4760:Abcc2	UTSW	19	43810481	missense	probably benign	0.03
R4801:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4802:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4976:Abcc2	UTSW	19	43800635	missense	probably benign	0.34
R5143:Abcc2	UTSW	19	43821661	missense	probably benign	0.28
R5206:Abcc2	UTSW	19	43818150	missense	probably damaging	1.00
R5376:Abcc2	UTSW	19	43829900	missense	possibly damaging	0.76
R5478:Abcc2	UTSW	19	43839465	utr 3 prime	probably benign
R5700:Abcc2	UTSW	19	43798194	missense	probably benign	0.22
R5863:Abcc2	UTSW	19	43798136	missense	probably benign	0.00
R5928:Abcc2	UTSW	19	43819358	missense	probably damaging	1.00
R5955:Abcc2	UTSW	19	43813190	missense	probably damaging	0.98
R5983:Abcc2	UTSW	19	43819503	missense	probably benign
R6014:Abcc2	UTSW	19	43826735	missense	probably benign
R6419:Abcc2	UTSW	19	43837508	splice site	probably null
R6497:Abcc2	UTSW	19	43805105	missense	probably damaging	1.00
R6510:Abcc2	UTSW	19	43782206	splice site	probably null
R6614:Abcc2	UTSW	19	43819361	missense	probably benign	0.01
R6649:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6653:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6670:Abcc2	UTSW	19	43839411	utr 3 prime	probably benign
R6964:Abcc2	UTSW	19	43798076	missense	probably benign	0.12
R6989:Abcc2	UTSW	19	43832172	missense	probably damaging	1.00
R7015:Abcc2	UTSW	19	43798178	missense	probably benign	0.03
R7026:Abcc2	UTSW	19	43816953	missense	probably benign	0.00
R7026:Abcc2	UTSW	19	43830535	missense	probably benign	0.01
R7136:Abcc2	UTSW	19	43837460	missense	probably damaging	1.00
R7252:Abcc2	UTSW	19	43827949	missense	probably damaging	0.98
R7293:Abcc2	UTSW	19	43807053	missense	probably damaging	1.00
R7392:Abcc2	UTSW	19	43808687	missense	probably damaging	0.97
R7450:Abcc2	UTSW	19	43822039	missense	probably damaging	1.00
R7654:Abcc2	UTSW	19	43826593	missense	possibly damaging	0.87
R7787:Abcc2	UTSW	19	43784246	missense	probably damaging	1.00
R7815:Abcc2	UTSW	19	43830427	missense	probably benign	0.01
R7911:Abcc2	UTSW	19	43803670	missense	probably benign	0.00
R7919:Abcc2	UTSW	19	43816809	missense	probably damaging	1.00
R7925:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
R7993:Abcc2	UTSW	19	43814792	missense	possibly damaging	0.71
R8097:Abcc2	UTSW	19	43816955	missense	probably benign	0.10
R8177:Abcc2	UTSW	19	43807080	missense	probably damaging	1.00
R8492:Abcc2	UTSW	19	43804971	missense	probably benign	0.07
R8693:Abcc2	UTSW	19	43822035	missense	probably benign	0.06
R8722:Abcc2	UTSW	19	43836613	missense	possibly damaging	0.89
R8734:Abcc2	UTSW	19	43782416	missense	probably damaging	1.00
R8774:Abcc2	UTSW	19	43799138	missense	probably damaging	0.99
R8774-TAIL:Abcc2	UTSW	19	43799138	missense	probably damaging	0.99
R8798:Abcc2	UTSW	19	43808666	missense	probably benign	0.01
R8889:Abcc2	UTSW	19	43807132	missense	possibly damaging	0.88
R8892:Abcc2	UTSW	19	43807132	missense	possibly damaging	0.88
R8936:Abcc2	UTSW	19	43808662	missense	probably benign	0.35
R9031:Abcc2	UTSW	19	43822027	missense	probably benign
R9116:Abcc2	UTSW	19	43804952	missense	probably benign	0.30
R9201:Abcc2	UTSW	19	43798441	missense	probably damaging	0.97
R9246:Abcc2	UTSW	19	43798443	missense	probably benign	0.01
R9345:Abcc2	UTSW	19	43819430	missense	probably damaging	0.97
R9487:Abcc2	UTSW	19	43818032	missense	probably damaging	1.00
X0025:Abcc2	UTSW	19	43832205	critical splice donor site	probably null
Z1177:Abcc2	UTSW	19	43803734	missense	probably benign	0.05
Z1177:Abcc2	UTSW	19	43803736	missense	probably benign	0.00
Z1177:Abcc2	UTSW	19	43823100	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCACTGTTCTGAAAGGTTACAAGCATC -3'
(R):5'- TGCTACAGCAATCTGCCTCATTGG -3'

Sequencing Primer
(F):5'- CTGAAAGGTTACAAGCATCCATTGAC -3'
(R):5'- tgtcctgtcgctatttccc -3'

Posted On

2013-06-11