Incidental Mutation 'R5899:Scpep1'
ID 457744
Institutional Source Beutler Lab
Gene Symbol Scpep1
Ensembl Gene ENSMUSG00000000278
Gene Name serine carboxypeptidase 1
Synonyms 4833411K15Rik, 2410018F01Rik, Risc
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5899 (G1)
Quality Score 154
Status Validated
Chromosome 11
Chromosomal Location 88924020-88955465 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88934576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000287]
AlphaFold Q920A5
Predicted Effect probably null
Transcript: ENSMUST00000000287
SMART Domains Protein: ENSMUSP00000000287
Gene: ENSMUSG00000000278

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_S10 29 451 2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139592
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit no abnormal phenotype. Mice homozygous for a knock-out allele exhibit abnormal blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Scpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Scpep1 APN 11 88952477 missense probably damaging 1.00
IGL01123:Scpep1 APN 11 88941328 missense possibly damaging 0.79
IGL02341:Scpep1 APN 11 88944488 missense probably benign 0.30
IGL03078:Scpep1 APN 11 88935831 missense possibly damaging 0.67
IGL03014:Scpep1 UTSW 11 88933445 splice site probably null
R1652:Scpep1 UTSW 11 88952434 nonsense probably null
R1966:Scpep1 UTSW 11 88952414 missense probably damaging 1.00
R4275:Scpep1 UTSW 11 88947142 splice site probably null
R4330:Scpep1 UTSW 11 88935903 nonsense probably null
R4331:Scpep1 UTSW 11 88935903 nonsense probably null
R4360:Scpep1 UTSW 11 88930244 missense possibly damaging 0.78
R4502:Scpep1 UTSW 11 88944385 missense probably benign 0.00
R4885:Scpep1 UTSW 11 88935911 missense probably benign 0.20
R4896:Scpep1 UTSW 11 88941296 missense probably damaging 1.00
R5010:Scpep1 UTSW 11 88941349 missense probably benign 0.30
R5229:Scpep1 UTSW 11 88937045 missense probably damaging 1.00
R5999:Scpep1 UTSW 11 88929313 missense possibly damaging 0.85
R6975:Scpep1 UTSW 11 88947205 missense probably damaging 0.98
R7098:Scpep1 UTSW 11 88929185 missense possibly damaging 0.59
R7637:Scpep1 UTSW 11 88929220 missense probably damaging 1.00
R7790:Scpep1 UTSW 11 88933521 missense possibly damaging 0.70
R8285:Scpep1 UTSW 11 88952467 missense probably damaging 1.00
R8750:Scpep1 UTSW 11 88944472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGAGACCAAGTGTTTACG -3'
(R):5'- TGGAAAGCCAAGACTTATCTGTTC -3'

Sequencing Primer
(F):5'- TGATCTACAGAGCCAGTTCCAGG -3'
(R):5'- TCTGCAACTTCGGTAGACG -3'
Posted On 2017-02-15