Incidental Mutation 'R5888:Thsd7b'
ID 457757
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Name thrombospondin, type I, domain containing 7B
Synonyms 1700074E13Rik, D130067I03Rik
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 129201039-130147015 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 130138057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1578 (Y1578*)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
AlphaFold Q6P4U0
Predicted Effect probably null
Transcript: ENSMUST00000073527
AA Change: Y1578*
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: Y1578*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129,523,571 (GRCm39) missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130,092,814 (GRCm39) missense probably benign 0.00
IGL00987:Thsd7b APN 1 129,541,016 (GRCm39) missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129,523,883 (GRCm39) missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129,704,071 (GRCm39) missense probably benign 0.29
IGL01535:Thsd7b APN 1 129,605,954 (GRCm39) missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130,145,918 (GRCm39) utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129,358,665 (GRCm39) missense probably benign 0.07
IGL01775:Thsd7b APN 1 129,556,676 (GRCm39) missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129,744,419 (GRCm39) missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129,523,508 (GRCm39) missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130,087,369 (GRCm39) missense probably benign 0.01
IGL02404:Thsd7b APN 1 129,540,888 (GRCm39) missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129,540,932 (GRCm39) missense probably benign 0.22
IGL02543:Thsd7b APN 1 130,092,840 (GRCm39) missense probably benign 0.03
IGL02740:Thsd7b APN 1 129,540,864 (GRCm39) missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129,843,352 (GRCm39) missense probably benign 0.01
IGL03108:Thsd7b APN 1 130,138,013 (GRCm39) missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130,116,288 (GRCm39) missense probably benign 0.00
IGL03195:Thsd7b APN 1 129,556,646 (GRCm39) missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129,688,092 (GRCm39) missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129,523,901 (GRCm39) missense probably benign 0.17
IGL03399:Thsd7b APN 1 129,556,622 (GRCm39) missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129,358,701 (GRCm39) missense probably benign 0.00
R0277:Thsd7b UTSW 1 130,123,000 (GRCm39) missense probably benign 0.00
R0526:Thsd7b UTSW 1 129,879,129 (GRCm39) missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130,116,263 (GRCm39) missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130,116,268 (GRCm39) missense probably benign 0.00
R0784:Thsd7b UTSW 1 129,523,096 (GRCm39) splice site probably benign
R1158:Thsd7b UTSW 1 130,117,672 (GRCm39) splice site probably null
R1267:Thsd7b UTSW 1 129,556,577 (GRCm39) splice site probably null
R1375:Thsd7b UTSW 1 130,087,423 (GRCm39) missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129,523,778 (GRCm39) missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1728:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1728:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1728:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1729:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1729:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1730:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1730:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1739:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1739:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1762:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1762:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 130,030,813 (GRCm39) missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1783:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1783:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1784:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1784:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1785:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1785:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1812:Thsd7b UTSW 1 129,686,347 (GRCm39) missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129,540,993 (GRCm39) missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129,605,846 (GRCm39) missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129,686,188 (GRCm39) nonsense probably null
R2199:Thsd7b UTSW 1 130,145,895 (GRCm39) missense probably benign 0.04
R2483:Thsd7b UTSW 1 130,030,809 (GRCm39) missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130,117,587 (GRCm39) splice site probably benign
R2935:Thsd7b UTSW 1 129,605,824 (GRCm39) missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 129,977,599 (GRCm39) missense probably benign 0.23
R3236:Thsd7b UTSW 1 130,145,855 (GRCm39) nonsense probably null
R3745:Thsd7b UTSW 1 129,605,978 (GRCm39) missense probably benign 0.04
R3877:Thsd7b UTSW 1 130,117,919 (GRCm39) missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129,523,107 (GRCm39) missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4112:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4255:Thsd7b UTSW 1 129,688,024 (GRCm39) missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129,358,652 (GRCm39) missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 129,977,646 (GRCm39) intron probably benign
R4732:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130,138,001 (GRCm39) missense probably benign 0.01
R4805:Thsd7b UTSW 1 130,116,276 (GRCm39) missense probably benign 0.04
R4840:Thsd7b UTSW 1 129,523,581 (GRCm39) missense probably benign 0.00
R4879:Thsd7b UTSW 1 130,116,236 (GRCm39) missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129,605,882 (GRCm39) missense probably benign 0.00
R4972:Thsd7b UTSW 1 130,116,309 (GRCm39) missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129,605,980 (GRCm39) nonsense probably null
R5422:Thsd7b UTSW 1 129,849,071 (GRCm39) missense probably benign 0.41
R5495:Thsd7b UTSW 1 129,523,570 (GRCm39) missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129,523,578 (GRCm39) missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130,090,673 (GRCm39) critical splice donor site probably null
R5638:Thsd7b UTSW 1 129,523,270 (GRCm39) missense probably benign 0.00
R5640:Thsd7b UTSW 1 130,044,408 (GRCm39) nonsense probably null
R5655:Thsd7b UTSW 1 129,556,671 (GRCm39) splice site probably null
R5711:Thsd7b UTSW 1 129,688,139 (GRCm39) missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129,605,821 (GRCm39) missense probably benign 0.00
R5932:Thsd7b UTSW 1 129,358,575 (GRCm39) missense probably benign
R6243:Thsd7b UTSW 1 130,090,599 (GRCm39) missense probably benign 0.21
R6258:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6260:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6399:Thsd7b UTSW 1 129,744,385 (GRCm39) missense probably benign 0.13
R6437:Thsd7b UTSW 1 129,744,419 (GRCm39) missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130,087,451 (GRCm39) splice site probably null
R6785:Thsd7b UTSW 1 129,358,644 (GRCm39) missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130,030,890 (GRCm39) missense probably benign 0.01
R7334:Thsd7b UTSW 1 130,123,012 (GRCm39) missense probably benign 0.00
R7414:Thsd7b UTSW 1 129,556,717 (GRCm39) missense probably damaging 0.99
R7673:Thsd7b UTSW 1 129,843,487 (GRCm39) splice site probably null
R7683:Thsd7b UTSW 1 129,523,683 (GRCm39) missense probably damaging 0.99
R7861:Thsd7b UTSW 1 130,087,435 (GRCm39) missense probably benign 0.00
R8145:Thsd7b UTSW 1 129,688,036 (GRCm39) missense probably damaging 1.00
R8241:Thsd7b UTSW 1 130,117,688 (GRCm39) missense probably damaging 1.00
R8296:Thsd7b UTSW 1 129,523,193 (GRCm39) missense probably benign 0.01
R8355:Thsd7b UTSW 1 129,523,616 (GRCm39) missense probably damaging 1.00
R8507:Thsd7b UTSW 1 129,605,790 (GRCm39) missense probably benign 0.21
R8520:Thsd7b UTSW 1 129,849,157 (GRCm39) missense probably benign 0.07
R8555:Thsd7b UTSW 1 129,523,191 (GRCm39) missense probably damaging 1.00
R8682:Thsd7b UTSW 1 129,688,011 (GRCm39) nonsense probably null
R8981:Thsd7b UTSW 1 129,523,187 (GRCm39) missense possibly damaging 0.88
R9029:Thsd7b UTSW 1 130,087,426 (GRCm39) missense probably damaging 1.00
R9133:Thsd7b UTSW 1 129,843,382 (GRCm39) missense probably benign 0.18
R9194:Thsd7b UTSW 1 129,843,371 (GRCm39) missense possibly damaging 0.78
R9229:Thsd7b UTSW 1 129,849,027 (GRCm39) missense probably damaging 1.00
R9239:Thsd7b UTSW 1 130,087,453 (GRCm39) critical splice donor site probably null
R9460:Thsd7b UTSW 1 130,090,674 (GRCm39) critical splice donor site probably null
R9466:Thsd7b UTSW 1 130,122,866 (GRCm39) missense probably benign
R9588:Thsd7b UTSW 1 130,108,223 (GRCm39) missense probably damaging 1.00
X0027:Thsd7b UTSW 1 129,523,809 (GRCm39) missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129,556,648 (GRCm39) missense probably benign 0.17
Z1176:Thsd7b UTSW 1 129,523,397 (GRCm39) missense probably benign 0.01
Z1176:Thsd7b UTSW 1 129,523,253 (GRCm39) missense probably damaging 0.98
Z1176:Thsd7b UTSW 1 130,108,161 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGCTCTGGTTTGTCAAACATTAG -3'
(R):5'- GTGTTAACAGTATTGGCAAAGGTC -3'

Sequencing Primer
(F):5'- CTGGTTTGTCAAACATTAGGTTACTC -3'
(R):5'- GCAAAGGTCCTGCATTTCAACTG -3'
Posted On 2017-02-15