Incidental Mutation 'R0559:Arl5b'
ID45776
Institutional Source Beutler Lab
Gene Symbol Arl5b
Ensembl Gene ENSMUSG00000017418
Gene NameADP-ribosylation factor-like 5B
Synonyms4930587A11Rik, Arl8
MMRRC Submission 038751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0559 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location15049395-15082456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15073187 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 108 (Y108H)
Ref Sequence ENSEMBL: ENSMUSP00000069725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017562] [ENSMUST00000069870] [ENSMUST00000128682] [ENSMUST00000193836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017562
AA Change: Y99H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017562
Gene: ENSMUSG00000017418
AA Change: Y99H

DomainStartEndE-ValueType
ARF 4 171 4.8e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069870
AA Change: Y108H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069725
Gene: ENSMUSG00000017418
AA Change: Y108H

DomainStartEndE-ValueType
ARF 2 180 3.95e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128682
Predicted Effect probably benign
Transcript: ENSMUST00000129509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192653
Predicted Effect probably benign
Transcript: ENSMUST00000193836
Predicted Effect probably benign
Transcript: ENSMUST00000193883
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARL5B (ARL8) belongs to a family of proteins that are structurally similar to ADP-ribosylation factors (ARFs; see MIM 103180). ARLs and ARFs are part of the RAS superfamily of regulatory GTPases.[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,698,535 I289F probably benign Het
Adam15 G A 3: 89,343,778 A540V probably damaging Het
Adat1 T C 8: 111,982,430 T254A probably damaging Het
Agtpbp1 A G 13: 59,497,000 V684A probably benign Het
Ahi1 A G 10: 21,000,719 probably benign Het
Cep85l A G 10: 53,348,501 F331L probably benign Het
Ctnna2 T C 6: 76,915,850 K785E probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dicer1 G A 12: 104,706,301 R896W probably damaging Het
Fbxl19 G T 7: 127,750,218 W160L possibly damaging Het
Gm21319 T A 12: 87,773,453 H112L probably benign Het
H1foo T C 6: 115,947,799 Y89H probably damaging Het
Ipo5 T C 14: 120,938,641 V626A probably damaging Het
Isx A G 8: 74,873,741 K34R probably benign Het
Myh6 T C 14: 54,958,554 E596G probably benign Het
Olfml2a T C 2: 38,959,820 I516T probably damaging Het
Olfr1135 T G 2: 87,671,900 T156P possibly damaging Het
Olfr126 C T 17: 37,850,855 R88* probably null Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Parp9 T C 16: 35,947,992 F181L probably benign Het
Pkdcc G A 17: 83,216,025 G187D probably benign Het
Plekhh3 C T 11: 101,164,766 E483K possibly damaging Het
Ptx4 C T 17: 25,123,108 Q186* probably null Het
Qsox2 T A 2: 26,214,157 H287L probably benign Het
Rev3l G A 10: 39,824,487 G1660D probably damaging Het
Scamp1 G T 13: 94,208,182 A217E possibly damaging Het
Slc5a9 T C 4: 111,885,582 I438V probably benign Het
Sort1 T C 3: 108,356,579 F818S probably damaging Het
Srl G A 16: 4,496,978 P267S probably benign Het
Tbc1d1 T C 5: 64,173,793 I105T probably damaging Het
Tifab A G 13: 56,176,247 Y128H probably benign Het
Trp53bp1 A T 2: 121,227,801 S907T probably damaging Het
Ubr1 G A 2: 120,947,883 R225* probably null Het
Upk3bl A G 5: 136,057,476 T89A probably benign Het
Vars T A 17: 35,014,058 C916* probably null Het
Ywhaz T C 15: 36,790,964 E5G possibly damaging Het
Zfp91 T C 19: 12,770,055 D568G probably damaging Het
Zgpat T C 2: 181,380,192 probably benign Het
Other mutations in Arl5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Arl5b APN 2 15069935 missense probably benign 0.03
IGL02374:Arl5b APN 2 15068192 missense probably damaging 1.00
IGL03213:Arl5b APN 2 15069865 missense probably damaging 1.00
IGL03396:Arl5b APN 2 15075104 missense probably damaging 0.96
R0959:Arl5b UTSW 2 15073131 missense probably damaging 1.00
R1160:Arl5b UTSW 2 15069837 missense probably benign 0.36
R1766:Arl5b UTSW 2 15069837 missense probably benign 0.36
R2100:Arl5b UTSW 2 15073195 missense probably benign 0.03
R2403:Arl5b UTSW 2 15075037 missense probably damaging 1.00
R4272:Arl5b UTSW 2 15073179 missense probably damaging 1.00
R6782:Arl5b UTSW 2 15073182 missense probably damaging 0.98
R7423:Arl5b UTSW 2 15068172 missense probably damaging 1.00
R7898:Arl5b UTSW 2 15075058 missense probably damaging 0.99
R7981:Arl5b UTSW 2 15075058 missense probably damaging 0.99
Z1088:Arl5b UTSW 2 15075021 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTAGCAGGGATAGTGCCAAGTG -3'
(R):5'- AGTTTTGTTGGTCTCCCACCATGAC -3'

Sequencing Primer
(F):5'- CCAAGTGAGAGCTAATGTTGATGC -3'
(R):5'- TTGTAGCAAGCAAATTAACAGGC -3'
Posted On2013-06-11