Incidental Mutation 'R5888:Olfr1283'
ID457765
Institutional Source Beutler Lab
Gene Symbol Olfr1283
Ensembl Gene ENSMUSG00000109322
Gene Nameolfactory receptor 1283
SynonymsGA_x6K02T2Q125-72420217-72421134, MOR248-19
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R5888 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111366790-111370063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111368743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 37 (M37T)
Ref Sequence ENSEMBL: ENSMUSP00000150510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]
Predicted Effect probably benign
Transcript: ENSMUST00000082167
AA Change: M37T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: M37T

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090328
AA Change: M37T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: M37T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204064
AA Change: M37T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: M37T

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216637
AA Change: M37T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Olfr1283
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Olfr1283 APN 2 111369151 missense probably benign 0.22
IGL02716:Olfr1283 APN 2 111368781 missense probably benign 0.04
R0090:Olfr1283 UTSW 2 111369294 missense probably damaging 1.00
R0141:Olfr1283 UTSW 2 111369490 missense probably damaging 1.00
R0371:Olfr1283 UTSW 2 111369153 missense probably benign 0.00
R0417:Olfr1283 UTSW 2 111369105 missense possibly damaging 0.57
R1673:Olfr1283 UTSW 2 111369207 missense probably benign 0.11
R1970:Olfr1283 UTSW 2 111369076 missense probably benign 0.19
R2069:Olfr1283 UTSW 2 111369095 missense probably benign 0.43
R3897:Olfr1283 UTSW 2 111368761 missense possibly damaging 0.87
R4408:Olfr1283 UTSW 2 111369280 missense possibly damaging 0.63
R5397:Olfr1283 UTSW 2 111368940 missense probably benign 0.00
R6281:Olfr1283 UTSW 2 111369549 makesense probably null
R6323:Olfr1283 UTSW 2 111368701 missense possibly damaging 0.94
R6801:Olfr1283 UTSW 2 111369049 missense probably benign 0.22
R7219:Olfr1283 UTSW 2 111369537 missense probably benign
R7271:Olfr1283 UTSW 2 111369348 missense probably damaging 1.00
R7438:Olfr1283 UTSW 2 111369362 missense probably damaging 1.00
R7761:Olfr1283 UTSW 2 111368793 missense probably benign 0.00
R7792:Olfr1283 UTSW 2 111369403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATCTATTCCTGGGAATTTTGTGC -3'
(R):5'- AGAGGATCTGGCTCATGCAG -3'

Sequencing Primer
(F):5'- CATTCCCTGACTAGAAAAAGTATAGC -3'
(R):5'- GCCCCCAAAGGAAATGGTTTTG -3'
Posted On2017-02-15